Mutagenetix > Incidental Mutation

Incidental Mutation 'R2426:Nr2e1'

250233

Institutional Source

Beutler Lab

Gene Symbol

Nr2e1

Ensembl Gene

ENSMUSG00000019803

Gene Name

nuclear receptor subfamily 2, group E, member 1

Synonyms

Mtll, Tlx, tailless, Nr2e1

MMRRC Submission

040388-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.886) question?

Stock #

R2426 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

42561963-42583632 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 42563485 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 134 (L134P)

Ref Sequence

ENSEMBL: ENSMUSP00000101137 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019938] [ENSMUST00000105498]

AlphaFold

Q64104

Predicted Effect

probably damaging
Transcript: ENSMUST00000019938
AA Change: L346P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000019938
Gene: ENSMUSG00000019803
AA Change: L346P

Domain	Start	End	E-Value	Type
ZnF_C4	13	86	2.04e-36	SMART
HOLI	187	354	1.42e-35	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105498
AA Change: L134P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000101137
Gene: ENSMUSG00000019803
AA Change: L134P

Domain	Start	End	E-Value	Type
HOLI	3	142	2.56e-10	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an orphan receptor involved in retinal development. The encoded protein also regulates adult neural stem cell proliferation and may be involved in control of aggressive behavior. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes have small brains, hypoplasia of cerebrum and olfactory lobes, thin optic layers, reduced retinal vessels and hydrocephaly on some genetic backgrounds. Mutants do poorly in sensorimotor tests, are aggressive and females lack maternal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	A	11: 23,576,801	R190W	probably damaging	Het
Abca14	G	T	7: 120,283,223	V1203L	probably benign	Het
Adamtsl1	G	A	4: 86,156,788	V131I	probably benign	Het
Adgra3	A	T	5: 50,009,449	M187K	possibly damaging	Het
Agbl1	T	C	7: 76,421,902	V324A	probably damaging	Het
Ahnak	A	T	19: 9,002,851	I500F	possibly damaging	Het
Aldh1l1	A	G	6: 90,598,284	D851G	probably damaging	Het
Amot	T	C	X: 145,476,291	K460E	probably damaging	Het
Arhgef3	G	T	14: 27,384,181	E161*	probably null	Het
Atg9b	A	T	5: 24,386,994	I669N	probably damaging	Het
AY761184	T	G	8: 21,702,637	K114N	possibly damaging	Het
Ccdc83	A	G	7: 90,228,431	Y268H	probably damaging	Het
Cep170	A	G	1: 176,774,635	S302P	probably benign	Het
Cyp4a31	T	A	4: 115,571,016	M303K	probably damaging	Het
Cyp4v3	T	A	8: 45,317,776	Y231F	probably benign	Het
Dock3	A	T	9: 106,914,541	L1411Q	possibly damaging	Het
Dsg1a	T	A	18: 20,336,804	I629N	probably damaging	Het
Dst	A	T	1: 34,192,812	H2837L	probably benign	Het
Fam114a2	G	A	11: 57,493,080	P343L	probably benign	Het
Fbrs	A	G	7: 127,487,339		probably null	Het
Fbxl13	A	C	5: 21,522,137	D620E	probably damaging	Het
Frmd4a	T	A	2: 4,529,862	S164T	probably damaging	Het
Gdi2	T	G	13: 3,562,034	S330A	probably benign	Het
Gm5878	A	T	6: 85,118,631	M70K	probably benign	Het
H2-Q6	G	T	17: 35,424,937	A21S	probably benign	Het
Hfm1	A	T	5: 106,847,653		probably null	Het
Hnmt	C	T	2: 24,019,155	C82Y	probably benign	Het
Il1rl1	C	A	1: 40,446,619	A310D	probably damaging	Het
Ints1	A	T	5: 139,771,814		probably null	Het
Kcne4	C	A	1: 78,817,971	A112E	possibly damaging	Het
Krt32	T	C	11: 100,086,366	K236R	possibly damaging	Het
Maml2	T	C	9: 13,706,498	L380P	probably damaging	Het
Meis1	A	T	11: 18,988,356	D218E	possibly damaging	Het
Mon1b	G	A	8: 113,639,120	G360D	probably damaging	Het
Mpp4	A	G	1: 59,130,057	S383P	probably damaging	Het
Neb	A	G	2: 52,169,053		probably null	Het
Nlgn2	A	T	11: 69,827,086	I431N	probably damaging	Het
Olfr329-ps	A	T	11: 58,543,094	Y127*	probably null	Het
Olfr371	T	C	8: 85,231,064	S190P	probably damaging	Het
Olfr777	T	C	10: 129,269,266	Q19R	probably benign	Het
Opcml	G	A	9: 28,903,367		probably null	Het
Pate2	A	T	9: 35,670,480		probably null	Het
Pgr	G	A	9: 8,900,717	V84M	probably damaging	Het
Pigu	A	T	2: 155,299,082	V296D	probably damaging	Het
Plcb2	G	A	2: 118,715,649	T555M	probably damaging	Het
Pld5	T	G	1: 175,963,976	D426A	probably benign	Het
Prdm2	G	T	4: 143,111,750	C1679*	probably null	Het
Psme2b	A	T	11: 48,946,063	V19D	probably benign	Het
Ptpn9	A	T	9: 57,027,428	N159Y	possibly damaging	Het
Sdc3	A	T	4: 130,818,803	T64S	unknown	Het
Serping1	T	G	2: 84,770,219	S260R	probably damaging	Het
Slc20a1	T	C	2: 129,208,230	F436S	probably benign	Het
Sntb1	A	T	15: 55,906,179	I138N	probably damaging	Het
Sorcs3	A	T	19: 48,722,925	Y643F	probably damaging	Het
Spink1	G	T	18: 43,735,222	S23*	probably null	Het
Stag1	T	C	9: 100,845,116		probably null	Het
Tnfaip8l1	G	A	17: 56,172,030	V107I	probably benign	Het
Tnik	A	G	3: 28,646,681	S907G	probably damaging	Het
Ttf1	T	A	2: 29,067,185	M489K	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Usp54	G	A	14: 20,564,940	A811V	probably benign	Het
Xirp2	A	G	2: 67,514,471	N2352S	probably benign	Het
Zan	T	C	5: 137,388,992	Y4933C	unknown	Het
Zbtb8a	A	G	4: 129,360,219	S161P	probably benign	Het
Zkscan5	A	T	5: 145,220,940	I751L	probably benign	Het
Zscan4d	A	G	7: 11,165,095	F85S	probably damaging	Het
Zzef1	A	G	11: 72,915,265	M2647V	probably benign	Het

Other mutations in Nr2e1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Nr2e1	APN	10	42568453	missense	probably damaging	1.00
IGL01936:Nr2e1	APN	10	42567973	missense	possibly damaging	0.90
IGL02272:Nr2e1	APN	10	42567979	missense	probably damaging	1.00
IGL03092:Nr2e1	APN	10	42571482	missense	probably damaging	1.00
IGL03405:Nr2e1	APN	10	42568381	missense	probably damaging	1.00
Dubious	UTSW	10	42571487	nonsense	probably null
BB010:Nr2e1	UTSW	10	42563383	missense	probably damaging	1.00
BB020:Nr2e1	UTSW	10	42563383	missense	probably damaging	1.00
R1581:Nr2e1	UTSW	10	42567968	missense	probably benign	0.12
R1807:Nr2e1	UTSW	10	42582909	splice site	probably null
R1879:Nr2e1	UTSW	10	42568371	critical splice donor site	probably null
R1944:Nr2e1	UTSW	10	42572778	missense	probably benign
R2842:Nr2e1	UTSW	10	42568445	missense	probably damaging	0.99
R4515:Nr2e1	UTSW	10	42578191	missense	probably benign
R5305:Nr2e1	UTSW	10	42571487	nonsense	probably null
R5316:Nr2e1	UTSW	10	42571491	missense	probably benign	0.10
R5325:Nr2e1	UTSW	10	42572784	missense	probably damaging	1.00
R5908:Nr2e1	UTSW	10	42572769	missense	probably benign
R7040:Nr2e1	UTSW	10	42568378	missense	probably damaging	0.99
R7593:Nr2e1	UTSW	10	42563479	missense	probably damaging	1.00
R7765:Nr2e1	UTSW	10	42574437	missense	probably benign	0.32
R7933:Nr2e1	UTSW	10	42563383	missense	probably damaging	1.00
R8158:Nr2e1	UTSW	10	42582885	missense	probably benign	0.00
R8342:Nr2e1	UTSW	10	42568429	missense	probably damaging	1.00
R8916:Nr2e1	UTSW	10	42567868	missense	possibly damaging	0.94
R9145:Nr2e1	UTSW	10	42572952	missense	probably benign	0.02
R9189:Nr2e1	UTSW	10	42578272	missense	probably damaging	0.99
R9381:Nr2e1	UTSW	10	42563472	missense	probably damaging	1.00
R9499:Nr2e1	UTSW	10	42571491	missense	probably benign	0.10
R9552:Nr2e1	UTSW	10	42571491	missense	probably benign	0.10
Z1177:Nr2e1	UTSW	10	42568427	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACCTGCATGTAGATGTCC -3'
(R):5'- TCCAGTAGTCATCCTGTGAAACAG -3'

Sequencing Primer
(F):5'- AGATGTCCATCTAATACTGCCC -3'
(R):5'- AGAGGCACCTGTCCTGAAGTC -3'

Posted On

2014-11-12