Mutagenetix > Incidental Mutations

Incidental Mutation 'R2426:Arhgef3'

250244

Institutional Source

Beutler Lab

Gene Symbol

Arhgef3

Ensembl Gene

ENSMUSG00000021895

Gene Name

Rho guanine nucleotide exchange factor (GEF) 3

Synonyms

9830169H03Rik, 1200004I24Rik, C76747

MMRRC Submission

040388-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.158) question?

Stock #

R2426 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27114899-27403911 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 27384181 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 161 (E161*)

Ref Sequence

ENSEMBL: ENSMUSP00000153396 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049206] [ENSMUST00000224981] [ENSMUST00000225949]

Predicted Effect

probably null
Transcript: ENSMUST00000049206
AA Change: E141*

SMART Domains

Protein: ENSMUSP00000046486
Gene: ENSMUSG00000021895
AA Change: E141*

Domain	Start	End	E-Value	Type
RhoGEF	132	309	4.11e-51	SMART
PH	318	457	3.26e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175293

Predicted Effect

probably null
Transcript: ENSMUST00000224981
AA Change: E134*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225494

Predicted Effect

probably null
Transcript: ENSMUST00000225949
AA Change: E161*

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho-like GTPases are involved in a variety of cellular processes, and they are activated by binding GTP and inactivated by conversion of GTP to GDP by their intrinsic GTPase activity. Guanine nucleotide exchange factors (GEFs) accelerate the GTPase activity of Rho GTPases by catalyzing their release of bound GDP. This gene encodes a guanine nucleotide exchange factor, which specifically activates two members of the Rho GTPase family: RHOA and RHOB, both of which have a role in bone cell biology. It has been identified that genetic variation in this gene plays a role in the determination of bone mineral density (BMD), indicating the implication of this gene in postmenopausal osteoporosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased mean platelet volume and a mild delay in platelet recovery in response to thrombocytopenia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	A	11: 23,576,801	R190W	probably damaging	Het
Abca14	G	T	7: 120,283,223	V1203L	probably benign	Het
Adamtsl1	G	A	4: 86,156,788	V131I	probably benign	Het
Adgra3	A	T	5: 50,009,449	M187K	possibly damaging	Het
Agbl1	T	C	7: 76,421,902	V324A	probably damaging	Het
Ahnak	A	T	19: 9,002,851	I500F	possibly damaging	Het
Aldh1l1	A	G	6: 90,598,284	D851G	probably damaging	Het
Amot	T	C	X: 145,476,291	K460E	probably damaging	Het
Atg9b	A	T	5: 24,386,994	I669N	probably damaging	Het
AY761184	T	G	8: 21,702,637	K114N	possibly damaging	Het
Ccdc83	A	G	7: 90,228,431	Y268H	probably damaging	Het
Cep170	A	G	1: 176,774,635	S302P	probably benign	Het
Cyp4a31	T	A	4: 115,571,016	M303K	probably damaging	Het
Cyp4v3	T	A	8: 45,317,776	Y231F	probably benign	Het
Dock3	A	T	9: 106,914,541	L1411Q	possibly damaging	Het
Dsg1a	T	A	18: 20,336,804	I629N	probably damaging	Het
Dst	A	T	1: 34,192,812	H2837L	probably benign	Het
Fam114a2	G	A	11: 57,493,080	P343L	probably benign	Het
Fbrs	A	G	7: 127,487,339		probably null	Het
Fbxl13	A	C	5: 21,522,137	D620E	probably damaging	Het
Frmd4a	T	A	2: 4,529,862	S164T	probably damaging	Het
Gdi2	T	G	13: 3,562,034	S330A	probably benign	Het
Gm5878	A	T	6: 85,118,631	M70K	probably benign	Het
H2-Q6	G	T	17: 35,424,937	A21S	probably benign	Het
Hfm1	A	T	5: 106,847,653		probably null	Het
Hnmt	C	T	2: 24,019,155	C82Y	probably benign	Het
Il1rl1	C	A	1: 40,446,619	A310D	probably damaging	Het
Ints1	A	T	5: 139,771,814		probably null	Het
Kcne4	C	A	1: 78,817,971	A112E	possibly damaging	Het
Krt32	T	C	11: 100,086,366	K236R	possibly damaging	Het
Maml2	T	C	9: 13,706,498	L380P	probably damaging	Het
Meis1	A	T	11: 18,988,356	D218E	possibly damaging	Het
Mon1b	G	A	8: 113,639,120	G360D	probably damaging	Het
Mpp4	A	G	1: 59,130,057	S383P	probably damaging	Het
Neb	A	G	2: 52,169,053		probably null	Het
Nlgn2	A	T	11: 69,827,086	I431N	probably damaging	Het
Nr2e1	A	G	10: 42,563,485	L134P	probably damaging	Het
Olfr329-ps	A	T	11: 58,543,094	Y127*	probably null	Het
Olfr371	T	C	8: 85,231,064	S190P	probably damaging	Het
Olfr777	T	C	10: 129,269,266	Q19R	probably benign	Het
Opcml	G	A	9: 28,903,367		probably null	Het
Pate2	A	T	9: 35,670,480		probably null	Het
Pgr	G	A	9: 8,900,717	V84M	probably damaging	Het
Pigu	A	T	2: 155,299,082	V296D	probably damaging	Het
Plcb2	G	A	2: 118,715,649	T555M	probably damaging	Het
Pld5	T	G	1: 175,963,976	D426A	probably benign	Het
Prdm2	G	T	4: 143,111,750	C1679*	probably null	Het
Psme2b	A	T	11: 48,946,063	V19D	probably benign	Het
Ptpn9	A	T	9: 57,027,428	N159Y	possibly damaging	Het
Sdc3	A	T	4: 130,818,803	T64S	unknown	Het
Serping1	T	G	2: 84,770,219	S260R	probably damaging	Het
Slc20a1	T	C	2: 129,208,230	F436S	probably benign	Het
Sntb1	A	T	15: 55,906,179	I138N	probably damaging	Het
Sorcs3	A	T	19: 48,722,925	Y643F	probably damaging	Het
Spink1	G	T	18: 43,735,222	S23*	probably null	Het
Stag1	T	C	9: 100,845,116		probably null	Het
Tnfaip8l1	G	A	17: 56,172,030	V107I	probably benign	Het
Tnik	A	G	3: 28,646,681	S907G	probably damaging	Het
Ttf1	T	A	2: 29,067,185	M489K	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Usp54	G	A	14: 20,564,940	A811V	probably benign	Het
Xirp2	A	G	2: 67,514,471	N2352S	probably benign	Het
Zan	T	C	5: 137,388,992	Y4933C	unknown	Het
Zbtb8a	A	G	4: 129,360,219	S161P	probably benign	Het
Zkscan5	A	T	5: 145,220,940	I751L	probably benign	Het
Zscan4d	A	G	7: 11,165,095	F85S	probably damaging	Het
Zzef1	A	G	11: 72,915,265	M2647V	probably benign	Het

Other mutations in Arhgef3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Arhgef3	APN	14	27401919	nonsense	probably null
IGL02178:Arhgef3	APN	14	27265529	nonsense	probably null
IGL02302:Arhgef3	APN	14	27362842	missense	probably benign	0.08
IGL02505:Arhgef3	APN	14	27394000	missense	possibly damaging	0.92
IGL03203:Arhgef3	APN	14	27394116	missense	probably damaging	1.00
IGL03339:Arhgef3	APN	14	27401857	missense	probably damaging	0.99
R0762:Arhgef3	UTSW	14	27397627	missense	probably damaging	1.00
R1192:Arhgef3	UTSW	14	27379706	missense	probably damaging	1.00
R1572:Arhgef3	UTSW	14	27401735	missense	probably damaging	1.00
R1794:Arhgef3	UTSW	14	27397605	missense	probably benign	0.44
R2509:Arhgef3	UTSW	14	27379676	missense	probably damaging	1.00
R4932:Arhgef3	UTSW	14	27384213	missense	probably damaging	0.99
R5017:Arhgef3	UTSW	14	27265530	missense	possibly damaging	0.85
R5216:Arhgef3	UTSW	14	27401842	missense	probably benign	0.00
R6562:Arhgef3	UTSW	14	27152996	start gained	probably benign
R6951:Arhgef3	UTSW	14	27144018	start gained	probably benign
R7140:Arhgef3	UTSW	14	27401707	missense	probably damaging	1.00
R7361:Arhgef3	UTSW	14	27265578	missense	possibly damaging	0.56
R7968:Arhgef3	UTSW	14	27386113	missense	probably damaging	0.99
R7968:Arhgef3	UTSW	14	27394105	missense	probably damaging	1.00
R7988:Arhgef3	UTSW	14	27401786	missense	probably benign	0.22
R8042:Arhgef3	UTSW	14	27362809	missense	possibly damaging	0.85
R8077:Arhgef3	UTSW	14	27385924	missense	probably damaging	1.00
R8303:Arhgef3	UTSW	14	27394138	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATTAAACCCAGGTGTTTGCAC -3'
(R):5'- AGAGCTACTTGCCTTCTTGC -3'

Sequencing Primer
(F):5'- GTTTGCACACACTCAACATATACTTC -3'
(R):5'- GAGCCATTTCCTTTGCTGCTGG -3'

Posted On

2014-11-12