Mutagenetix > Incidental Mutation

Incidental Mutation 'R2426:Sorcs3'

250252

Institutional Source

Beutler Lab

Gene Symbol

Sorcs3

Ensembl Gene

ENSMUSG00000063434

Gene Name

sortilin-related VPS10 domain containing receptor 3

Synonyms

6330404A12Rik

MMRRC Submission

040388-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R2426 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

48206025-48805505 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 48722925 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 643 (Y643F)

Ref Sequence

ENSEMBL: ENSMUSP00000077919 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078880]

AlphaFold

Q8VI51

Predicted Effect

probably damaging
Transcript: ENSMUST00000078880
AA Change: Y643F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: Y643F

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	46	63	N/A	INTRINSIC
low complexity region	69	91	N/A	INTRINSIC
VPS10	216	818	N/A	SMART
Pfam:PKD	823	901	8e-13	PFAM
transmembrane domain	1122	1141	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	A	11: 23,576,801	R190W	probably damaging	Het
Abca14	G	T	7: 120,283,223	V1203L	probably benign	Het
Adamtsl1	G	A	4: 86,156,788	V131I	probably benign	Het
Adgra3	A	T	5: 50,009,449	M187K	possibly damaging	Het
Agbl1	T	C	7: 76,421,902	V324A	probably damaging	Het
Ahnak	A	T	19: 9,002,851	I500F	possibly damaging	Het
Aldh1l1	A	G	6: 90,598,284	D851G	probably damaging	Het
Amot	T	C	X: 145,476,291	K460E	probably damaging	Het
Arhgef3	G	T	14: 27,384,181	E161*	probably null	Het
Atg9b	A	T	5: 24,386,994	I669N	probably damaging	Het
AY761184	T	G	8: 21,702,637	K114N	possibly damaging	Het
Ccdc83	A	G	7: 90,228,431	Y268H	probably damaging	Het
Cep170	A	G	1: 176,774,635	S302P	probably benign	Het
Cyp4a31	T	A	4: 115,571,016	M303K	probably damaging	Het
Cyp4v3	T	A	8: 45,317,776	Y231F	probably benign	Het
Dock3	A	T	9: 106,914,541	L1411Q	possibly damaging	Het
Dsg1a	T	A	18: 20,336,804	I629N	probably damaging	Het
Dst	A	T	1: 34,192,812	H2837L	probably benign	Het
Fam114a2	G	A	11: 57,493,080	P343L	probably benign	Het
Fbrs	A	G	7: 127,487,339		probably null	Het
Fbxl13	A	C	5: 21,522,137	D620E	probably damaging	Het
Frmd4a	T	A	2: 4,529,862	S164T	probably damaging	Het
Gdi2	T	G	13: 3,562,034	S330A	probably benign	Het
Gm5878	A	T	6: 85,118,631	M70K	probably benign	Het
H2-Q6	G	T	17: 35,424,937	A21S	probably benign	Het
Hfm1	A	T	5: 106,847,653		probably null	Het
Hnmt	C	T	2: 24,019,155	C82Y	probably benign	Het
Il1rl1	C	A	1: 40,446,619	A310D	probably damaging	Het
Ints1	A	T	5: 139,771,814		probably null	Het
Kcne4	C	A	1: 78,817,971	A112E	possibly damaging	Het
Krt32	T	C	11: 100,086,366	K236R	possibly damaging	Het
Maml2	T	C	9: 13,706,498	L380P	probably damaging	Het
Meis1	A	T	11: 18,988,356	D218E	possibly damaging	Het
Mon1b	G	A	8: 113,639,120	G360D	probably damaging	Het
Mpp4	A	G	1: 59,130,057	S383P	probably damaging	Het
Neb	A	G	2: 52,169,053		probably null	Het
Nlgn2	A	T	11: 69,827,086	I431N	probably damaging	Het
Nr2e1	A	G	10: 42,563,485	L134P	probably damaging	Het
Olfr329-ps	A	T	11: 58,543,094	Y127*	probably null	Het
Olfr371	T	C	8: 85,231,064	S190P	probably damaging	Het
Olfr777	T	C	10: 129,269,266	Q19R	probably benign	Het
Opcml	G	A	9: 28,903,367		probably null	Het
Pate2	A	T	9: 35,670,480		probably null	Het
Pgr	G	A	9: 8,900,717	V84M	probably damaging	Het
Pigu	A	T	2: 155,299,082	V296D	probably damaging	Het
Plcb2	G	A	2: 118,715,649	T555M	probably damaging	Het
Pld5	T	G	1: 175,963,976	D426A	probably benign	Het
Prdm2	G	T	4: 143,111,750	C1679*	probably null	Het
Psme2b	A	T	11: 48,946,063	V19D	probably benign	Het
Ptpn9	A	T	9: 57,027,428	N159Y	possibly damaging	Het
Sdc3	A	T	4: 130,818,803	T64S	unknown	Het
Serping1	T	G	2: 84,770,219	S260R	probably damaging	Het
Slc20a1	T	C	2: 129,208,230	F436S	probably benign	Het
Sntb1	A	T	15: 55,906,179	I138N	probably damaging	Het
Spink1	G	T	18: 43,735,222	S23*	probably null	Het
Stag1	T	C	9: 100,845,116		probably null	Het
Tnfaip8l1	G	A	17: 56,172,030	V107I	probably benign	Het
Tnik	A	G	3: 28,646,681	S907G	probably damaging	Het
Ttf1	T	A	2: 29,067,185	M489K	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Usp54	G	A	14: 20,564,940	A811V	probably benign	Het
Xirp2	A	G	2: 67,514,471	N2352S	probably benign	Het
Zan	T	C	5: 137,388,992	Y4933C	unknown	Het
Zbtb8a	A	G	4: 129,360,219	S161P	probably benign	Het
Zkscan5	A	T	5: 145,220,940	I751L	probably benign	Het
Zscan4d	A	G	7: 11,165,095	F85S	probably damaging	Het
Zzef1	A	G	11: 72,915,265	M2647V	probably benign	Het

Other mutations in Sorcs3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sorcs3	APN	19	48683658	critical splice donor site	probably null
IGL00233:Sorcs3	APN	19	48748319	missense	probably benign	0.12
IGL00482:Sorcs3	APN	19	48603864	missense	probably benign	0.00
IGL00976:Sorcs3	APN	19	48767103	missense	probably damaging	1.00
IGL01367:Sorcs3	APN	19	48796375	missense	probably damaging	1.00
IGL01390:Sorcs3	APN	19	48790131	missense	probably damaging	1.00
IGL01548:Sorcs3	APN	19	48794168	missense	possibly damaging	0.87
IGL02162:Sorcs3	APN	19	48535531	missense	probably damaging	0.98
IGL02165:Sorcs3	APN	19	48654072	missense	probably benign	0.03
IGL02404:Sorcs3	APN	19	48704370	splice site	probably benign
IGL02830:Sorcs3	APN	19	48723002	splice site	probably null
IGL02943:Sorcs3	APN	19	48759938	missense	probably benign	0.00
R0371:Sorcs3	UTSW	19	48603894	missense	probably benign	0.00
R0456:Sorcs3	UTSW	19	48654044	missense	possibly damaging	0.94
R0466:Sorcs3	UTSW	19	48748319	missense	probably benign	0.12
R0470:Sorcs3	UTSW	19	48797517	critical splice donor site	probably null
R0536:Sorcs3	UTSW	19	48802698	nonsense	probably null
R0646:Sorcs3	UTSW	19	48206295	missense	probably benign	0.10
R0709:Sorcs3	UTSW	19	48487406	missense	probably benign
R0792:Sorcs3	UTSW	19	48706009	missense	possibly damaging	0.84
R0831:Sorcs3	UTSW	19	48693994	missense	probably damaging	1.00
R0836:Sorcs3	UTSW	19	48487394	missense	probably benign
R1253:Sorcs3	UTSW	19	48206736	missense	possibly damaging	0.67
R1390:Sorcs3	UTSW	19	48694001	critical splice donor site	probably null
R1522:Sorcs3	UTSW	19	48706009	missense	possibly damaging	0.84
R1570:Sorcs3	UTSW	19	48764181	missense	probably damaging	1.00
R1637:Sorcs3	UTSW	19	48748359	critical splice donor site	probably null
R1766:Sorcs3	UTSW	19	48603875	missense	possibly damaging	0.87
R1894:Sorcs3	UTSW	19	48794274	missense	probably benign	0.23
R3789:Sorcs3	UTSW	19	48398711	missense	possibly damaging	0.46
R3818:Sorcs3	UTSW	19	48603904	missense	probably benign	0.00
R3824:Sorcs3	UTSW	19	48722956	missense	probably damaging	1.00
R3934:Sorcs3	UTSW	19	48713504	missense	probably damaging	1.00
R3936:Sorcs3	UTSW	19	48713504	missense	probably damaging	1.00
R4190:Sorcs3	UTSW	19	48749373	missense	possibly damaging	0.69
R4604:Sorcs3	UTSW	19	48693914	missense	probably benign	0.35
R4644:Sorcs3	UTSW	19	48683597	missense	probably damaging	1.00
R4774:Sorcs3	UTSW	19	48794163	missense	probably benign	0.23
R4801:Sorcs3	UTSW	19	48398744	missense	possibly damaging	0.46
R4802:Sorcs3	UTSW	19	48398744	missense	possibly damaging	0.46
R4945:Sorcs3	UTSW	19	48764148	missense	possibly damaging	0.50
R5049:Sorcs3	UTSW	19	48759951	missense	possibly damaging	0.93
R5175:Sorcs3	UTSW	19	48759845	critical splice acceptor site	probably null
R5342:Sorcs3	UTSW	19	48796472	splice site	probably null
R5848:Sorcs3	UTSW	19	48788511	missense	probably damaging	1.00
R5959:Sorcs3	UTSW	19	48749396	missense	probably damaging	1.00
R5977:Sorcs3	UTSW	19	48796450	missense	probably damaging	1.00
R6155:Sorcs3	UTSW	19	48398697	missense	possibly damaging	0.94
R6222:Sorcs3	UTSW	19	48759857	missense	possibly damaging	0.57
R6268:Sorcs3	UTSW	19	48790166	missense	probably damaging	1.00
R6416:Sorcs3	UTSW	19	48802759	missense	probably damaging	1.00
R6425:Sorcs3	UTSW	19	48764307	critical splice donor site	probably null
R6623:Sorcs3	UTSW	19	48788505	missense	probably benign	0.00
R6767:Sorcs3	UTSW	19	48713571	missense	probably damaging	0.99
R6888:Sorcs3	UTSW	19	48693824	missense	possibly damaging	0.83
R6955:Sorcs3	UTSW	19	48749343	missense	possibly damaging	0.82
R7106:Sorcs3	UTSW	19	48705963	missense	probably damaging	1.00
R7379:Sorcs3	UTSW	19	48772266	missense	possibly damaging	0.69
R7953:Sorcs3	UTSW	19	48764295	missense	possibly damaging	0.84
R8043:Sorcs3	UTSW	19	48764295	missense	possibly damaging	0.84
R8242:Sorcs3	UTSW	19	48206474	missense	possibly damaging	0.53
R8343:Sorcs3	UTSW	19	48704369	splice site	probably null
R8433:Sorcs3	UTSW	19	48206474	missense	possibly damaging	0.53
R8435:Sorcs3	UTSW	19	48206474	missense	possibly damaging	0.53
R8436:Sorcs3	UTSW	19	48206474	missense	possibly damaging	0.53
R8940:Sorcs3	UTSW	19	48796469	critical splice donor site	probably null
R8956:Sorcs3	UTSW	19	48749371	nonsense	probably null
R9051:Sorcs3	UTSW	19	48206370	missense	probably benign
R9119:Sorcs3	UTSW	19	48653994	missense	possibly damaging	0.92
R9166:Sorcs3	UTSW	19	48796372	missense	probably benign	0.01
R9328:Sorcs3	UTSW	19	48797511	missense	probably damaging	1.00
R9489:Sorcs3	UTSW	19	48722925	missense	probably damaging	1.00
R9605:Sorcs3	UTSW	19	48722925	missense	probably damaging	1.00
R9757:Sorcs3	UTSW	19	48722924	missense	probably damaging	1.00
X0018:Sorcs3	UTSW	19	48772289	missense	probably damaging	1.00
Z1176:Sorcs3	UTSW	19	48645804	missense	probably damaging	1.00
Z1177:Sorcs3	UTSW	19	48704300	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTCCTGCGAAGAGAAATTTTGATC -3'
(R):5'- CAATTAGGGCTCGAGTTCCTG -3'

Sequencing Primer
(F):5'- CTGCGAAGAGAAATTTTGATCAAATC -3'
(R):5'- GGAAACTCTTGCTTTGAGAAGAAATG -3'

Posted On

2014-11-12