Incidental Mutation 'R2427:Lrrc71'
ID250261
Institutional Source Beutler Lab
Gene Symbol Lrrc71
Ensembl Gene ENSMUSG00000023084
Gene Nameleucine rich repeat containing 71
Synonyms
MMRRC Submission 040389-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2427 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87736923-87748625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87746002 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 64 (T64A)
Ref Sequence ENSEMBL: ENSMUSP00000023846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023846] [ENSMUST00000029714] [ENSMUST00000079083] [ENSMUST00000090981] [ENSMUST00000172621] [ENSMUST00000174267] [ENSMUST00000174713] [ENSMUST00000174759]
Predicted Effect probably benign
Transcript: ENSMUST00000023846
AA Change: T64A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023846
Gene: ENSMUSG00000023084
AA Change: T64A

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Blast:LRR 165 191 6e-7 BLAST
LRR 219 246 4.24e-1 SMART
LRR 251 278 1.33e-1 SMART
LRR 279 306 1.98e-4 SMART
low complexity region 312 323 N/A INTRINSIC
low complexity region 329 337 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 407 414 N/A INTRINSIC
LRR 472 499 1.83e2 SMART
low complexity region 547 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079083
SMART Domains Protein: ENSMUSP00000078090
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172621
SMART Domains Protein: ENSMUSP00000133474
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174208
Predicted Effect probably benign
Transcript: ENSMUST00000174267
SMART Domains Protein: ENSMUSP00000133626
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174381
Predicted Effect probably benign
Transcript: ENSMUST00000174581
SMART Domains Protein: ENSMUSP00000134711
Gene: ENSMUSG00000023084

DomainStartEndE-ValueType
Blast:LRR 67 94 1e-10 BLAST
low complexity region 142 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174713
SMART Domains Protein: ENSMUSP00000134215
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174759
SMART Domains Protein: ENSMUSP00000133323
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,109,761 F277L probably benign Het
Ankmy1 A G 1: 92,870,807 probably null Het
Atp2a1 T A 7: 126,446,583 *995L probably null Het
Axin2 T A 11: 108,923,974 N229K possibly damaging Het
Capn13 A T 17: 73,326,317 probably benign Het
Ccdc180 A G 4: 45,929,545 I1202V probably benign Het
Cep295 A G 9: 15,334,238 L974P probably damaging Het
Cers3 T C 7: 66,795,793 Y321H probably benign Het
Chrnb4 T C 9: 55,034,817 Y391C probably benign Het
Ciao1 T C 2: 127,246,691 H104R probably damaging Het
Cldn4 A T 5: 134,946,477 V90E probably damaging Het
Crbn T C 6: 106,783,472 E253G probably damaging Het
Ctns A G 11: 73,196,686 W5R probably damaging Het
Eme1 G A 11: 94,650,975 probably benign Het
Fam19a4 C T 6: 97,014,367 probably benign Het
Fat2 T A 11: 55,310,812 T479S probably benign Het
Fbxw25 T C 9: 109,652,860 N253D probably benign Het
Fer A G 17: 63,957,303 I39V probably benign Het
Fmnl2 A G 2: 53,116,979 M768V probably damaging Het
Frg1 T C 8: 41,414,866 K24E probably damaging Het
I830077J02Rik G T 3: 105,928,004 A19D probably damaging Het
Ighv1-20 C T 12: 114,724,072 silent Het
Igsf9 A G 1: 172,490,739 S149G probably damaging Het
Klra10 T A 6: 130,279,335 I119F probably benign Het
Lrrc4b T A 7: 44,462,552 I616N probably damaging Het
Ly9 A T 1: 171,607,232 I31N probably damaging Het
Mef2a A G 7: 67,266,060 S165P probably damaging Het
Nol4 T G 18: 22,850,698 probably benign Het
Plxnd1 C T 6: 115,967,748 probably null Het
Rab27b T C 18: 69,996,134 T30A probably damaging Het
Rasa4 A G 5: 136,102,027 D384G probably benign Het
Slx4 G A 16: 3,988,987 L531F probably damaging Het
Tgm1 C T 14: 55,712,100 probably null Het
Tpm2 T C 4: 43,523,306 N17D probably damaging Het
Tyrp1 A G 4: 80,850,871 T134A probably benign Het
Zfand6 T A 7: 84,634,290 K35* probably null Het
Zfp648 G A 1: 154,205,073 C326Y probably damaging Het
Other mutations in Lrrc71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Lrrc71 APN 3 87745224 splice site probably null
IGL02387:Lrrc71 APN 3 87743071 missense probably damaging 0.96
IGL02632:Lrrc71 APN 3 87743340 missense probably damaging 1.00
IGL02701:Lrrc71 APN 3 87741772 missense probably benign 0.37
R0372:Lrrc71 UTSW 3 87745777 missense probably benign 0.40
R0505:Lrrc71 UTSW 3 87745699 missense probably damaging 0.98
R0827:Lrrc71 UTSW 3 87742645 splice site probably null
R1511:Lrrc71 UTSW 3 87745484 missense probably benign 0.00
R1541:Lrrc71 UTSW 3 87741841 missense possibly damaging 0.87
R1987:Lrrc71 UTSW 3 87742643 missense probably benign 0.25
R2054:Lrrc71 UTSW 3 87742673 missense probably damaging 1.00
R2143:Lrrc71 UTSW 3 87745521 nonsense probably null
R3700:Lrrc71 UTSW 3 87745878 splice site probably null
R4073:Lrrc71 UTSW 3 87745262 missense probably benign 0.01
R4231:Lrrc71 UTSW 3 87740991 missense probably benign 0.01
R4431:Lrrc71 UTSW 3 87742836 missense possibly damaging 0.59
R4477:Lrrc71 UTSW 3 87742665 missense probably damaging 0.99
R4562:Lrrc71 UTSW 3 87745408 unclassified probably benign
R4563:Lrrc71 UTSW 3 87745408 unclassified probably benign
R4564:Lrrc71 UTSW 3 87745408 unclassified probably benign
R4724:Lrrc71 UTSW 3 87739174 missense probably damaging 0.97
R4826:Lrrc71 UTSW 3 87743308 missense probably benign 0.33
R5156:Lrrc71 UTSW 3 87745787 missense probably benign 0.07
R5631:Lrrc71 UTSW 3 87739149 missense probably benign 0.00
R6182:Lrrc71 UTSW 3 87745794 missense probably benign 0.41
R6558:Lrrc71 UTSW 3 87742643 missense probably benign 0.25
R6885:Lrrc71 UTSW 3 87742620 splice site probably null
R7036:Lrrc71 UTSW 3 87748386 missense probably benign 0.00
R7199:Lrrc71 UTSW 3 87743077 missense probably damaging 1.00
R7211:Lrrc71 UTSW 3 87743326 missense possibly damaging 0.92
R7634:Lrrc71 UTSW 3 87742974 missense probably damaging 1.00
R7638:Lrrc71 UTSW 3 87741806 missense probably damaging 1.00
R7695:Lrrc71 UTSW 3 87739462 missense probably damaging 1.00
Z1177:Lrrc71 UTSW 3 87742821 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACGGTCTCTGGTCATCTAGAAAAC -3'
(R):5'- CGGCTAGGTAGGTATAGATCCC -3'

Sequencing Primer
(F):5'- TCTCTGGTCATCTAGAAAACAGAGAG -3'
(R):5'- AGGTATAGATCCCTTTCTGTGAGCC -3'
Posted On2014-11-12