Incidental Mutation 'R2427:Tyrp1'
ID250266
Institutional Source Beutler Lab
Gene Symbol Tyrp1
Ensembl Gene ENSMUSG00000005994
Gene Nametyrosinase-related protein 1
SynonymsTyrp, isa, Oca3, TRP1, TRP-1
MMRRC Submission 040389-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R2427 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location80834123-80851719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80850871 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 134 (T134A)
Ref Sequence ENSEMBL: ENSMUSP00000119167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006151] [ENSMUST00000102831] [ENSMUST00000133932]
Predicted Effect probably benign
Transcript: ENSMUST00000006151
AA Change: H534R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006151
Gene: ENSMUSG00000005994
AA Change: H534R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tyrosinase 182 417 1.7e-37 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102831
AA Change: H534R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099895
Gene: ENSMUSG00000005994
AA Change: H534R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tyrosinase 182 417 4.9e-38 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133932
AA Change: T134A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119167
Gene: ENSMUSG00000005994
AA Change: T134A

DomainStartEndE-ValueType
Pfam:Tyrosinase 1 51 1e-12 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a melanosomal enzyme that belongs to the tyrosinase family and plays an important role in the melanin biosynthetic pathway. Defects in this gene are the cause of rufous oculocutaneous albinism and oculocutaneous albinism type III. [provided by RefSeq, Mar 2009]
PHENOTYPE: The major influence of mutations at this locus is to change eumelanin from a black to a brown pigment in the coat and eyes in varying degrees. Semidominant mutants result in melanocyte degeneration causing reduced pigmentation and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,109,761 F277L probably benign Het
Ankmy1 A G 1: 92,870,807 probably null Het
Atp2a1 T A 7: 126,446,583 *995L probably null Het
Axin2 T A 11: 108,923,974 N229K possibly damaging Het
Capn13 A T 17: 73,326,317 probably benign Het
Ccdc180 A G 4: 45,929,545 I1202V probably benign Het
Cep295 A G 9: 15,334,238 L974P probably damaging Het
Cers3 T C 7: 66,795,793 Y321H probably benign Het
Chrnb4 T C 9: 55,034,817 Y391C probably benign Het
Ciao1 T C 2: 127,246,691 H104R probably damaging Het
Cldn4 A T 5: 134,946,477 V90E probably damaging Het
Crbn T C 6: 106,783,472 E253G probably damaging Het
Ctns A G 11: 73,196,686 W5R probably damaging Het
Eme1 G A 11: 94,650,975 probably benign Het
Fam19a4 C T 6: 97,014,367 probably benign Het
Fat2 T A 11: 55,310,812 T479S probably benign Het
Fbxw25 T C 9: 109,652,860 N253D probably benign Het
Fer A G 17: 63,957,303 I39V probably benign Het
Fmnl2 A G 2: 53,116,979 M768V probably damaging Het
Frg1 T C 8: 41,414,866 K24E probably damaging Het
I830077J02Rik G T 3: 105,928,004 A19D probably damaging Het
Ighv1-20 C T 12: 114,724,072 silent Het
Igsf9 A G 1: 172,490,739 S149G probably damaging Het
Klra10 T A 6: 130,279,335 I119F probably benign Het
Lrrc4b T A 7: 44,462,552 I616N probably damaging Het
Lrrc71 T C 3: 87,746,002 T64A probably benign Het
Ly9 A T 1: 171,607,232 I31N probably damaging Het
Mef2a A G 7: 67,266,060 S165P probably damaging Het
Nol4 T G 18: 22,850,698 probably benign Het
Plxnd1 C T 6: 115,967,748 probably null Het
Rab27b T C 18: 69,996,134 T30A probably damaging Het
Rasa4 A G 5: 136,102,027 D384G probably benign Het
Slx4 G A 16: 3,988,987 L531F probably damaging Het
Tgm1 C T 14: 55,712,100 probably null Het
Tpm2 T C 4: 43,523,306 N17D probably damaging Het
Zfand6 T A 7: 84,634,290 K35* probably null Het
Zfp648 G A 1: 154,205,073 C326Y probably damaging Het
Other mutations in Tyrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Tyrp1 APN 4 80840765 missense possibly damaging 0.95
IGL01586:Tyrp1 APN 4 80844898 missense probably benign 0.00
IGL01620:Tyrp1 APN 4 80844802 nonsense probably null
IGL02126:Tyrp1 APN 4 80837608 nonsense probably null
IGL02174:Tyrp1 APN 4 80844826 nonsense probably null
IGL02601:Tyrp1 APN 4 80840775 missense probably null 0.00
IGL02630:Tyrp1 APN 4 80840757 missense possibly damaging 0.95
butter UTSW 4 80840806 critical splice donor site probably null
ca-los UTSW 4 80844868 nonsense probably null
chi UTSW 4 80840778 missense probably damaging 1.00
R0011:Tyrp1 UTSW 4 80840793 missense probably damaging 1.00
R0011:Tyrp1 UTSW 4 80840793 missense probably damaging 1.00
R0145:Tyrp1 UTSW 4 80840778 missense probably damaging 1.00
R1172:Tyrp1 UTSW 4 80844868 nonsense probably null
R1173:Tyrp1 UTSW 4 80844868 nonsense probably null
R1175:Tyrp1 UTSW 4 80844868 nonsense probably null
R1886:Tyrp1 UTSW 4 80840806 critical splice donor site probably null
R2099:Tyrp1 UTSW 4 80835379 missense possibly damaging 0.69
R2273:Tyrp1 UTSW 4 80837534 missense probably damaging 0.99
R2274:Tyrp1 UTSW 4 80837534 missense probably damaging 0.99
R2275:Tyrp1 UTSW 4 80837534 missense probably damaging 0.99
R2312:Tyrp1 UTSW 4 80837564 nonsense probably null
R2440:Tyrp1 UTSW 4 80846606 missense probably benign 0.41
R2915:Tyrp1 UTSW 4 80837455 missense possibly damaging 0.46
R4343:Tyrp1 UTSW 4 80849841 missense possibly damaging 0.92
R4512:Tyrp1 UTSW 4 80837512 missense probably damaging 1.00
R4703:Tyrp1 UTSW 4 80840806 critical splice donor site probably null
R4732:Tyrp1 UTSW 4 80844935 missense possibly damaging 0.67
R4733:Tyrp1 UTSW 4 80844935 missense possibly damaging 0.67
R4788:Tyrp1 UTSW 4 80844943 nonsense probably null
R4834:Tyrp1 UTSW 4 80846596 nonsense probably null
R4911:Tyrp1 UTSW 4 80850907 utr 3 prime probably benign
R4938:Tyrp1 UTSW 4 80840646 missense probably damaging 1.00
R5129:Tyrp1 UTSW 4 80846607 missense probably damaging 1.00
R5154:Tyrp1 UTSW 4 80850717 missense probably benign 0.00
R6249:Tyrp1 UTSW 4 80850772 missense possibly damaging 0.93
R6492:Tyrp1 UTSW 4 80840781 missense probably null 1.00
R6617:Tyrp1 UTSW 4 80846747 missense probably benign 0.24
R6870:Tyrp1 UTSW 4 80850777 missense probably benign 0.37
R6990:Tyrp1 UTSW 4 80835437 missense probably damaging 1.00
R7275:Tyrp1 UTSW 4 80837584 missense possibly damaging 0.78
R7684:Tyrp1 UTSW 4 80840625 missense probably damaging 1.00
R7980:Tyrp1 UTSW 4 80840627 missense probably damaging 1.00
R8001:Tyrp1 UTSW 4 80840670 missense probably benign 0.10
R8051:Tyrp1 UTSW 4 80837660 missense probably damaging 1.00
R8233:Tyrp1 UTSW 4 80850953 missense unknown
R8326:Tyrp1 UTSW 4 80850684 missense probably benign 0.06
Z1176:Tyrp1 UTSW 4 80844889 nonsense probably null
Z1177:Tyrp1 UTSW 4 80849817 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATCATTACCATTGCTGTAGTGGC -3'
(R):5'- TCCTCTCAGATATCACACAACTGG -3'

Sequencing Primer
(F):5'- CTGCGTTGTTACTTGTAGCTGCC -3'
(R):5'- CACACAACTGGTATAATTTGCCATC -3'
Posted On2014-11-12