Mutagenetix > Incidental Mutation

Incidental Mutation 'R2427:Plxnd1'

250271

Institutional Source

Beutler Lab

Gene Symbol

Plxnd1

Ensembl Gene

ENSMUSG00000030123

Gene Name

plexin D1

Synonyms

6230425C21Rik, b2b1863Clo, b2b553Clo

MMRRC Submission

040389-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2427 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115931772-115971966 bp(-) (GRCm39)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 115944709 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015511] [ENSMUST00000015511]

AlphaFold

Q3UH93

Predicted Effect

probably null
Transcript: ENSMUST00000015511

SMART Domains

Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123

Domain	Start	End	E-Value	Type
signal peptide	1	48	N/A	INTRINSIC
Sema	61	531	6.52e-90	SMART
PSI	550	603	6.06e-12	SMART
PSI	703	755	1.06e-2	SMART
Blast:PSI	850	891	9e-20	BLAST
IPT	892	981	4.43e-20	SMART
IPT	982	1068	6.61e-19	SMART
IPT	1070	1149	6.13e-14	SMART
transmembrane domain	1271	1293	N/A	INTRINSIC
Pfam:Plexin_cytopl	1345	1888	5e-238	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000015511

SMART Domains

Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123

Domain	Start	End	E-Value	Type
signal peptide	1	48	N/A	INTRINSIC
Sema	61	531	6.52e-90	SMART
PSI	550	603	6.06e-12	SMART
PSI	703	755	1.06e-2	SMART
Blast:PSI	850	891	9e-20	BLAST
IPT	892	981	4.43e-20	SMART
IPT	982	1068	6.61e-19	SMART
IPT	1070	1149	6.13e-14	SMART
transmembrane domain	1271	1293	N/A	INTRINSIC
Pfam:Plexin_cytopl	1345	1888	5e-238	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000131590

SMART Domains

Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123

Domain	Start	End	E-Value	Type
Blast:PSI	2	34	1e-13	BLAST
IPT	35	124	4.43e-20	SMART
Blast:IPT	125	177	3e-30	BLAST
Pfam:TIG	180	233	4.6e-6	PFAM

Meta Mutation Damage Score

0.9470

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (37/37)

MGI Phenotype

PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankmy1	A	G	1: 92,798,529 (GRCm39)		probably null	Het
Atp2a1	T	A	7: 126,045,755 (GRCm39)	*995L	probably null	Het
Axin2	T	A	11: 108,814,800 (GRCm39)	N229K	possibly damaging	Het
Capn13	A	T	17: 73,633,312 (GRCm39)		probably benign	Het
Ccdc180	A	G	4: 45,929,545 (GRCm39)	I1202V	probably benign	Het
Cep295	A	G	9: 15,245,534 (GRCm39)	L974P	probably damaging	Het
Cers3	T	C	7: 66,445,541 (GRCm39)	Y321H	probably benign	Het
Chrnb4	T	C	9: 54,942,101 (GRCm39)	Y391C	probably benign	Het
Ciao1	T	C	2: 127,088,611 (GRCm39)	H104R	probably damaging	Het
Cldn4	A	T	5: 134,975,331 (GRCm39)	V90E	probably damaging	Het
Crbn	T	C	6: 106,760,433 (GRCm39)	E253G	probably damaging	Het
Ctns	A	G	11: 73,087,512 (GRCm39)	W5R	probably damaging	Het
Eme1	G	A	11: 94,541,801 (GRCm39)		probably benign	Het
Fat2	T	A	11: 55,201,638 (GRCm39)	T479S	probably benign	Het
Fbxw25	T	C	9: 109,481,928 (GRCm39)	N253D	probably benign	Het
Fer	A	G	17: 64,264,298 (GRCm39)	I39V	probably benign	Het
Fmnl2	A	G	2: 53,006,991 (GRCm39)	M768V	probably damaging	Het
Frg1	T	C	8: 41,867,903 (GRCm39)	K24E	probably damaging	Het
I830077J02Rik	G	T	3: 105,835,320 (GRCm39)	A19D	probably damaging	Het
Ighv1-20	C	T	12: 114,687,692 (GRCm39)		silent	Het
Igsf9	A	G	1: 172,318,306 (GRCm39)	S149G	probably damaging	Het
Klra10	T	A	6: 130,256,298 (GRCm39)	I119F	probably benign	Het
Lrrc4b	T	A	7: 44,111,976 (GRCm39)	I616N	probably damaging	Het
Lrrc71	T	C	3: 87,653,309 (GRCm39)	T64A	probably benign	Het
Ly9	A	T	1: 171,434,800 (GRCm39)	I31N	probably damaging	Het
Mef2a	A	G	7: 66,915,808 (GRCm39)	S165P	probably damaging	Het
Nol4	T	G	18: 22,983,755 (GRCm39)		probably benign	Het
Nt5el	T	C	13: 105,246,269 (GRCm39)	F277L	probably benign	Het
Rab27b	T	C	18: 70,129,205 (GRCm39)	T30A	probably damaging	Het
Rasa4	A	G	5: 136,130,881 (GRCm39)	D384G	probably benign	Het
Slx4	G	A	16: 3,806,851 (GRCm39)	L531F	probably damaging	Het
Tafa4	C	T	6: 96,991,328 (GRCm39)		probably benign	Het
Tgm1	C	T	14: 55,949,557 (GRCm39)		probably null	Het
Tpm2	T	C	4: 43,523,306 (GRCm39)	N17D	probably damaging	Het
Tyrp1	A	G	4: 80,769,108 (GRCm39)	T134A	probably benign	Het
Zfand6	T	A	7: 84,283,498 (GRCm39)	K35*	probably null	Het
Zfp648	G	A	1: 154,080,819 (GRCm39)	C326Y	probably damaging	Het

Other mutations in Plxnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Plxnd1	APN	6	115,944,933 (GRCm39)	missense	possibly damaging	0.51
IGL01099:Plxnd1	APN	6	115,946,906 (GRCm39)	missense	probably benign
IGL01323:Plxnd1	APN	6	115,943,760 (GRCm39)	missense	possibly damaging	0.81
IGL01382:Plxnd1	APN	6	115,937,488 (GRCm39)	missense	probably damaging	1.00
IGL01786:Plxnd1	APN	6	115,936,896 (GRCm39)	missense	probably damaging	1.00
IGL02244:Plxnd1	APN	6	115,955,218 (GRCm39)	missense	probably benign	0.39
IGL02272:Plxnd1	APN	6	115,970,589 (GRCm39)	missense	probably damaging	1.00
IGL02293:Plxnd1	APN	6	115,940,874 (GRCm39)	missense	probably damaging	1.00
IGL02465:Plxnd1	APN	6	115,932,703 (GRCm39)	makesense	probably null
IGL02873:Plxnd1	APN	6	115,936,937 (GRCm39)	missense	probably damaging	1.00
IGL03209:Plxnd1	APN	6	115,939,318 (GRCm39)	missense	probably damaging	1.00
Hiss	UTSW	6	115,946,890 (GRCm39)	missense	possibly damaging	0.94
murmer	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
mutter	UTSW	6	115,945,005 (GRCm39)	missense	probably benign	0.27
rattle	UTSW	6	115,936,755 (GRCm39)	missense	probably damaging	0.96
R0238:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0238:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0357:Plxnd1	UTSW	6	115,946,421 (GRCm39)	missense	probably benign	0.00
R0646:Plxnd1	UTSW	6	115,935,660 (GRCm39)	splice site	probably benign
R0648:Plxnd1	UTSW	6	115,970,962 (GRCm39)	missense	possibly damaging	0.86
R0718:Plxnd1	UTSW	6	115,943,599 (GRCm39)	missense	possibly damaging	0.68
R1116:Plxnd1	UTSW	6	115,943,966 (GRCm39)	splice site	probably null
R1292:Plxnd1	UTSW	6	115,939,644 (GRCm39)	unclassified	probably benign
R1715:Plxnd1	UTSW	6	115,945,642 (GRCm39)	missense	probably benign	0.02
R1760:Plxnd1	UTSW	6	115,944,740 (GRCm39)	missense	possibly damaging	0.95
R1799:Plxnd1	UTSW	6	115,971,018 (GRCm39)	missense	probably damaging	1.00
R1817:Plxnd1	UTSW	6	115,957,562 (GRCm39)	missense	possibly damaging	0.83
R1848:Plxnd1	UTSW	6	115,943,507 (GRCm39)	missense	probably damaging	1.00
R1851:Plxnd1	UTSW	6	115,940,875 (GRCm39)	missense	probably damaging	1.00
R1864:Plxnd1	UTSW	6	115,946,402 (GRCm39)	splice site	probably null
R1865:Plxnd1	UTSW	6	115,946,402 (GRCm39)	splice site	probably null
R1875:Plxnd1	UTSW	6	115,955,045 (GRCm39)	splice site	probably null
R1899:Plxnd1	UTSW	6	115,946,324 (GRCm39)	missense	probably benign
R1913:Plxnd1	UTSW	6	115,954,978 (GRCm39)	missense	possibly damaging	0.50
R1970:Plxnd1	UTSW	6	115,939,478 (GRCm39)	missense	probably damaging	1.00
R2007:Plxnd1	UTSW	6	115,944,216 (GRCm39)	missense	probably damaging	1.00
R2134:Plxnd1	UTSW	6	115,934,509 (GRCm39)	missense	probably damaging	1.00
R2202:Plxnd1	UTSW	6	115,939,725 (GRCm39)	missense	probably benign	0.45
R2230:Plxnd1	UTSW	6	115,941,105 (GRCm39)	missense	probably damaging	1.00
R2267:Plxnd1	UTSW	6	115,939,704 (GRCm39)	missense	probably benign	0.29
R4108:Plxnd1	UTSW	6	115,936,276 (GRCm39)	missense	probably damaging	1.00
R4233:Plxnd1	UTSW	6	115,942,914 (GRCm39)	missense	probably benign	0.30
R4280:Plxnd1	UTSW	6	115,933,056 (GRCm39)	splice site	probably null
R4280:Plxnd1	UTSW	6	115,933,055 (GRCm39)	splice site	probably benign
R4346:Plxnd1	UTSW	6	115,954,941 (GRCm39)	missense	probably benign	0.16
R4439:Plxnd1	UTSW	6	115,970,937 (GRCm39)	missense	probably damaging	0.99
R4572:Plxnd1	UTSW	6	115,932,717 (GRCm39)	missense	probably damaging	1.00
R4576:Plxnd1	UTSW	6	115,945,005 (GRCm39)	missense	probably benign	0.27
R4599:Plxnd1	UTSW	6	115,971,237 (GRCm39)	missense	probably damaging	1.00
R4614:Plxnd1	UTSW	6	115,949,486 (GRCm39)	missense	possibly damaging	0.83
R4700:Plxnd1	UTSW	6	115,935,576 (GRCm39)	missense	probably damaging	1.00
R4705:Plxnd1	UTSW	6	115,935,581 (GRCm39)	missense	probably damaging	1.00
R4806:Plxnd1	UTSW	6	115,937,816 (GRCm39)	missense	probably damaging	1.00
R4944:Plxnd1	UTSW	6	115,932,726 (GRCm39)	missense	probably damaging	1.00
R4977:Plxnd1	UTSW	6	115,971,337 (GRCm39)	missense	probably damaging	1.00
R5069:Plxnd1	UTSW	6	115,942,862 (GRCm39)	missense	probably damaging	0.98
R5155:Plxnd1	UTSW	6	115,935,949 (GRCm39)	critical splice donor site	probably null
R5460:Plxnd1	UTSW	6	115,934,609 (GRCm39)	missense	probably damaging	1.00
R5729:Plxnd1	UTSW	6	115,942,838 (GRCm39)	missense	probably damaging	1.00
R5909:Plxnd1	UTSW	6	115,945,649 (GRCm39)	missense	probably benign	0.00
R5992:Plxnd1	UTSW	6	115,944,748 (GRCm39)	critical splice acceptor site	probably null
R6129:Plxnd1	UTSW	6	115,955,135 (GRCm39)	missense	probably damaging	1.00
R6254:Plxnd1	UTSW	6	115,954,921 (GRCm39)	missense	probably benign	0.01
R6273:Plxnd1	UTSW	6	115,955,453 (GRCm39)	missense	probably damaging	1.00
R6310:Plxnd1	UTSW	6	115,953,697 (GRCm39)	missense	possibly damaging	0.94
R6732:Plxnd1	UTSW	6	115,946,890 (GRCm39)	missense	possibly damaging	0.94
R6857:Plxnd1	UTSW	6	115,970,724 (GRCm39)	missense	probably benign	0.05
R7243:Plxnd1	UTSW	6	115,949,468 (GRCm39)	missense	probably benign	0.00
R7282:Plxnd1	UTSW	6	115,937,798 (GRCm39)	missense	probably damaging	1.00
R7632:Plxnd1	UTSW	6	115,953,600 (GRCm39)	missense	probably benign
R7699:Plxnd1	UTSW	6	115,936,755 (GRCm39)	missense	probably damaging	0.96
R7915:Plxnd1	UTSW	6	115,943,879 (GRCm39)	missense	probably benign	0.00
R8090:Plxnd1	UTSW	6	115,933,578 (GRCm39)	missense	probably damaging	1.00
R8382:Plxnd1	UTSW	6	115,949,433 (GRCm39)	missense	probably benign
R8507:Plxnd1	UTSW	6	115,943,866 (GRCm39)	missense	probably damaging	0.97
R8539:Plxnd1	UTSW	6	115,939,768 (GRCm39)	missense	possibly damaging	0.94
R8548:Plxnd1	UTSW	6	115,934,558 (GRCm39)	missense	probably damaging	1.00
R8963:Plxnd1	UTSW	6	115,949,506 (GRCm39)	nonsense	probably null
R9119:Plxnd1	UTSW	6	115,932,832 (GRCm39)	splice site	probably benign
R9177:Plxnd1	UTSW	6	115,943,469 (GRCm39)	missense	probably benign	0.00
R9182:Plxnd1	UTSW	6	115,970,746 (GRCm39)	missense	probably damaging	0.98
R9185:Plxnd1	UTSW	6	115,934,526 (GRCm39)	missense	probably damaging	1.00
R9226:Plxnd1	UTSW	6	115,934,524 (GRCm39)	missense	probably damaging	1.00
R9433:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R9449:Plxnd1	UTSW	6	115,932,730 (GRCm39)	missense	probably damaging	1.00
R9451:Plxnd1	UTSW	6	115,940,277 (GRCm39)	missense	possibly damaging	0.72
R9599:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
R9627:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
R9644:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
R9672:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
X0024:Plxnd1	UTSW	6	115,940,271 (GRCm39)	missense	probably benign	0.02
X0026:Plxnd1	UTSW	6	115,943,745 (GRCm39)	missense	possibly damaging	0.88
Z1088:Plxnd1	UTSW	6	115,944,471 (GRCm39)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TTGTTCACCCACTGCAGGTC -3'
(R):5'- GTTCTCCTATGTGGTAAGTAGGCC -3'

Sequencing Primer
(F):5'- AGGTCCCTCAGCCTTGTG -3'
(R):5'- TGGTAAGTAGGCCACCACCTC -3'

Posted On

2014-11-12