Incidental Mutation 'R2427:Eme1'
ID250285
Institutional Source Beutler Lab
Gene Symbol Eme1
Ensembl Gene ENSMUSG00000039055
Gene Nameessential meiotic structure-specific endonuclease 1
Synonyms
MMRRC Submission 040389-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2427 (G1)
Quality Score204
Status Validated
Chromosome11
Chromosomal Location94644996-94653964 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 94650975 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025278] [ENSMUST00000039949]
Predicted Effect probably benign
Transcript: ENSMUST00000025278
SMART Domains Protein: ENSMUSP00000025278
Gene: ENSMUSG00000024414

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:Ribosomal_L27 31 114 2e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000039949
AA Change: S7F
SMART Domains Protein: ENSMUSP00000036361
Gene: ENSMUSG00000039055
AA Change: S7F

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
ERCC4 252 515 2.06e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132813
Meta Mutation Damage Score 0.0668 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that complexes with methyl methanesulfonate-sensitive UV-sensitive 81 protein to form an endonuclease complex. The encoded protein interacts with specifc DNA structures including nicked Holliday junctions, 3'-flap structures and aberrant replication fork structures. This protein may be involved in repairing DNA damage and in maintaining genomic stability. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,109,761 F277L probably benign Het
Ankmy1 A G 1: 92,870,807 probably null Het
Atp2a1 T A 7: 126,446,583 *995L probably null Het
Axin2 T A 11: 108,923,974 N229K possibly damaging Het
Capn13 A T 17: 73,326,317 probably benign Het
Ccdc180 A G 4: 45,929,545 I1202V probably benign Het
Cep295 A G 9: 15,334,238 L974P probably damaging Het
Cers3 T C 7: 66,795,793 Y321H probably benign Het
Chrnb4 T C 9: 55,034,817 Y391C probably benign Het
Ciao1 T C 2: 127,246,691 H104R probably damaging Het
Cldn4 A T 5: 134,946,477 V90E probably damaging Het
Crbn T C 6: 106,783,472 E253G probably damaging Het
Ctns A G 11: 73,196,686 W5R probably damaging Het
Fam19a4 C T 6: 97,014,367 probably benign Het
Fat2 T A 11: 55,310,812 T479S probably benign Het
Fbxw25 T C 9: 109,652,860 N253D probably benign Het
Fer A G 17: 63,957,303 I39V probably benign Het
Fmnl2 A G 2: 53,116,979 M768V probably damaging Het
Frg1 T C 8: 41,414,866 K24E probably damaging Het
I830077J02Rik G T 3: 105,928,004 A19D probably damaging Het
Ighv1-20 C T 12: 114,724,072 silent Het
Igsf9 A G 1: 172,490,739 S149G probably damaging Het
Klra10 T A 6: 130,279,335 I119F probably benign Het
Lrrc4b T A 7: 44,462,552 I616N probably damaging Het
Lrrc71 T C 3: 87,746,002 T64A probably benign Het
Ly9 A T 1: 171,607,232 I31N probably damaging Het
Mef2a A G 7: 67,266,060 S165P probably damaging Het
Nol4 T G 18: 22,850,698 probably benign Het
Plxnd1 C T 6: 115,967,748 probably null Het
Rab27b T C 18: 69,996,134 T30A probably damaging Het
Rasa4 A G 5: 136,102,027 D384G probably benign Het
Slx4 G A 16: 3,988,987 L531F probably damaging Het
Tgm1 C T 14: 55,712,100 probably null Het
Tpm2 T C 4: 43,523,306 N17D probably damaging Het
Tyrp1 A G 4: 80,850,871 T134A probably benign Het
Zfand6 T A 7: 84,634,290 K35* probably null Het
Zfp648 G A 1: 154,205,073 C326Y probably damaging Het
Other mutations in Eme1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Eme1 APN 11 94645451 missense probably damaging 1.00
IGL02402:Eme1 APN 11 94650907 missense possibly damaging 0.65
R0220:Eme1 UTSW 11 94650258 missense probably null 1.00
R0594:Eme1 UTSW 11 94650430 missense possibly damaging 0.63
R0608:Eme1 UTSW 11 94650082 missense probably damaging 1.00
R0842:Eme1 UTSW 11 94650874 missense probably benign 0.24
R0925:Eme1 UTSW 11 94650732 missense probably damaging 0.99
R1146:Eme1 UTSW 11 94645451 missense probably damaging 1.00
R1146:Eme1 UTSW 11 94645451 missense probably damaging 1.00
R1161:Eme1 UTSW 11 94645542 missense probably damaging 1.00
R1310:Eme1 UTSW 11 94645542 missense probably damaging 1.00
R1837:Eme1 UTSW 11 94645961 missense probably benign 0.14
R2138:Eme1 UTSW 11 94648192 missense probably damaging 1.00
R2420:Eme1 UTSW 11 94645814 critical splice donor site probably null
R3807:Eme1 UTSW 11 94650592 missense probably damaging 1.00
R4230:Eme1 UTSW 11 94647992 missense possibly damaging 0.69
R6889:Eme1 UTSW 11 94650477 missense probably benign 0.00
R7752:Eme1 UTSW 11 94650819 missense probably damaging 1.00
R7759:Eme1 UTSW 11 94645840 nonsense probably null
R7901:Eme1 UTSW 11 94650819 missense probably damaging 1.00
X0021:Eme1 UTSW 11 94650518 missense possibly damaging 0.56
Z1176:Eme1 UTSW 11 94650696 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGCTTAGCACTCTGACTGGC -3'
(R):5'- CTGAGGGCATGTCCTGTTTC -3'

Sequencing Primer
(F):5'- GACACATGGTGGACCTTTGAG -3'
(R):5'- AGGGCATGTCCTGTTTCTCTGATTC -3'
Posted On2014-11-12