Incidental Mutation 'R2428:Zdbf2'
ID 250292
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Name zinc finger, DBF-type containing 2
Synonyms 4930431J08Rik, 9330107J05Rik
MMRRC Submission 040390-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock # R2428 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 63273265-63314576 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63305615 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 1051 (M1051T)
Ref Sequence ENSEMBL: ENSMUSP00000109767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
AlphaFold Q5SS00
Predicted Effect probably benign
Transcript: ENSMUST00000029025
AA Change: M1051T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: M1051T

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114132
AA Change: M1051T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: M1051T

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,746,126 S1080L possibly damaging Het
Acad9 G A 3: 36,090,923 A624T probably benign Het
Astn1 C T 1: 158,612,346 A828V possibly damaging Het
Bag6 A C 17: 35,147,175 D1117A probably damaging Het
Col12a1 A T 9: 79,602,251 C3042S probably benign Het
Ctc1 G A 11: 69,027,701 V265I possibly damaging Het
Cubn T C 2: 13,476,150 Y298C probably damaging Het
Dmtn G A 14: 70,613,403 R183W probably damaging Het
F2rl2 T A 13: 95,697,077 I5N possibly damaging Het
Gpr137c A G 14: 45,278,963 Y336C probably damaging Het
Gstm6 T A 3: 107,943,606 I10F possibly damaging Het
Hivep3 T A 4: 120,098,508 C1340* probably null Het
Igf1 A G 10: 87,864,821 T36A probably damaging Het
Lrch1 T A 14: 74,807,545 probably benign Het
Mrpl40 A T 16: 18,872,375 I195N probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ndufc1 A C 3: 51,408,143 probably null Het
Nfasc T C 1: 132,595,654 N973S possibly damaging Het
Olfr1013 A T 2: 85,769,978 Y59F probably damaging Het
Olfr1318 G A 2: 112,156,442 V164I probably benign Het
Olfr644 G A 7: 104,068,468 R188* probably null Het
Olfr805 T C 10: 129,722,783 I254V probably benign Het
Pkdrej C A 15: 85,817,572 E1388* probably null Het
Prrc2b T A 2: 32,216,055 D1482E probably benign Het
Sppl2a A T 2: 126,912,695 S403R possibly damaging Het
Tespa1 A G 10: 130,362,075 D322G probably damaging Het
Tmcc2 C T 1: 132,360,831 V373M probably damaging Het
Ttn T C 2: 76,814,173 N13079S possibly damaging Het
Wdr53 A G 16: 32,252,190 I118V probably benign Het
Zfp784 G C 7: 5,038,358 probably benign Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63306514 missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63307205 missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63303038 missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63303077 missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63308074 missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63304006 nonsense probably null
R0148:Zdbf2 UTSW 1 63304006 nonsense probably null
R0433:Zdbf2 UTSW 1 63306143 missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63305290 missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63304950 missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63305723 missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63303430 missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63303002 missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63303053 missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63303040 missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63303588 missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63303859 missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63304334 missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63308972 missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63304249 nonsense probably null
R1700:Zdbf2 UTSW 1 63302741 missense unknown
R1720:Zdbf2 UTSW 1 63303277 missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63305542 frame shift probably null
R1854:Zdbf2 UTSW 1 63305542 frame shift probably null
R1973:Zdbf2 UTSW 1 63309701 missense unknown
R2336:Zdbf2 UTSW 1 63303464 missense probably benign 0.00
R3010:Zdbf2 UTSW 1 63303065 missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63304205 missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63307477 missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63308420 missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63308671 missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63308324 missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63309781 missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63302861 missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63306591 missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63308792 missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63303238 missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63308814 missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63302914 missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63303650 missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63304903 missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63304411 missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63307933 missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63305677 missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63305876 missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63306526 missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63280818 start gained probably benign
R6245:Zdbf2 UTSW 1 63304433 missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63307822 missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63303321 missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63307478 missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63305520 missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63303914 missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63304508 missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63304520 missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63308528 missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63308872 missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63290766 missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63306766 missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63307404 missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63307559 missense probably benign
R7177:Zdbf2 UTSW 1 63294961 missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63306505 missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63303404 missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63304039 missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63307510 missense probably benign
R7695:Zdbf2 UTSW 1 63307370 missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63305371 missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63304105 missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63308007 nonsense probably null
R7759:Zdbf2 UTSW 1 63308376 missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63303424 missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63306827 missense possibly damaging 0.46
R7970:Zdbf2 UTSW 1 63304171 missense possibly damaging 0.92
R8076:Zdbf2 UTSW 1 63306101 missense possibly damaging 0.92
R8152:Zdbf2 UTSW 1 63306413 missense possibly damaging 0.92
R8195:Zdbf2 UTSW 1 63304066 missense possibly damaging 0.83
R8272:Zdbf2 UTSW 1 63305983 missense probably benign
R8306:Zdbf2 UTSW 1 63304075 missense possibly damaging 0.66
R8309:Zdbf2 UTSW 1 63306591 missense possibly damaging 0.82
R8323:Zdbf2 UTSW 1 63302914 missense possibly damaging 0.46
R8400:Zdbf2 UTSW 1 63304976 missense possibly damaging 0.92
R8443:Zdbf2 UTSW 1 63306007 missense possibly damaging 0.83
R8460:Zdbf2 UTSW 1 63309570 small deletion probably benign
R8528:Zdbf2 UTSW 1 63303386 missense possibly damaging 0.82
R8812:Zdbf2 UTSW 1 63308113 missense probably benign 0.00
R8962:Zdbf2 UTSW 1 63308003 missense probably benign 0.00
R9061:Zdbf2 UTSW 1 63307137 missense
R9072:Zdbf2 UTSW 1 63305764 missense possibly damaging 0.83
R9232:Zdbf2 UTSW 1 63308009 missense possibly damaging 0.66
R9257:Zdbf2 UTSW 1 63306241 missense probably damaging 1.00
R9411:Zdbf2 UTSW 1 63304129 missense probably damaging 0.97
R9470:Zdbf2 UTSW 1 63305625 missense possibly damaging 0.82
R9606:Zdbf2 UTSW 1 63303377 missense possibly damaging 0.92
R9621:Zdbf2 UTSW 1 63303476 missense possibly damaging 0.66
RF021:Zdbf2 UTSW 1 63302652 missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63305351 missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63308007 nonsense probably null
X0057:Zdbf2 UTSW 1 63305390 missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63305537 missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63304245 missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63304086 frame shift probably null
Z1177:Zdbf2 UTSW 1 63309203 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTAAGTTCAGCTTCTACTGCTTC -3'
(R):5'- AACTCTTGTTTAGGCAGGGAG -3'

Sequencing Primer
(F):5'- CCCAGTGACAGAACCTTATGTAG -3'
(R):5'- CTTGTTTAGGCAGGGAGTGAAAATG -3'
Posted On 2014-11-12