Incidental Mutation 'R2428:Tmcc2'
ID 250294
Institutional Source Beutler Lab
Gene Symbol Tmcc2
Ensembl Gene ENSMUSG00000042066
Gene Name transmembrane and coiled-coil domains 2
Synonyms 1110063G11Rik
MMRRC Submission 040390-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R2428 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 132284053-132319019 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 132288569 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 373 (V373M)
Ref Sequence ENSEMBL: ENSMUSP00000038369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045473] [ENSMUST00000132435] [ENSMUST00000142609]
AlphaFold Q80W04
Predicted Effect probably damaging
Transcript: ENSMUST00000045473
AA Change: V373M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038369
Gene: ENSMUSG00000042066
AA Change: V373M

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 100 112 N/A INTRINSIC
low complexity region 164 183 N/A INTRINSIC
low complexity region 253 267 N/A INTRINSIC
Pfam:Tmemb_cc2 283 694 6.3e-178 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125439
Predicted Effect probably damaging
Transcript: ENSMUST00000132435
AA Change: V295M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118844
Gene: ENSMUSG00000042066
AA Change: V295M

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 86 105 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
Pfam:Tmemb_cc2 203 617 1.1e-193 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138717
Predicted Effect possibly damaging
Transcript: ENSMUST00000142609
AA Change: V138M

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115721
Gene: ENSMUSG00000042066
AA Change: V138M

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Tmemb_cc2 46 460 2.2e-194 PFAM
Meta Mutation Damage Score 0.1446 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 G A 3: 36,145,072 (GRCm39) A624T probably benign Het
Astn1 C T 1: 158,439,916 (GRCm39) A828V possibly damaging Het
Bag6 A C 17: 35,366,151 (GRCm39) D1117A probably damaging Het
Col12a1 A T 9: 79,509,533 (GRCm39) C3042S probably benign Het
Ctc1 G A 11: 68,918,527 (GRCm39) V265I possibly damaging Het
Cubn T C 2: 13,480,961 (GRCm39) Y298C probably damaging Het
Dmtn G A 14: 70,850,843 (GRCm39) R183W probably damaging Het
F2rl2 T A 13: 95,833,585 (GRCm39) I5N possibly damaging Het
Gpr137c A G 14: 45,516,420 (GRCm39) Y336C probably damaging Het
Gstm6 T A 3: 107,850,922 (GRCm39) I10F possibly damaging Het
Hivep3 T A 4: 119,955,705 (GRCm39) C1340* probably null Het
Igf1 A G 10: 87,700,683 (GRCm39) T36A probably damaging Het
Lrch1 T A 14: 75,044,985 (GRCm39) probably benign Het
Mrpl40 A T 16: 18,691,125 (GRCm39) I195N probably damaging Het
Myg1 G C 15: 102,246,171 (GRCm39) G349R probably damaging Het
Ndufc1 A C 3: 51,315,564 (GRCm39) probably null Het
Nfasc T C 1: 132,523,392 (GRCm39) N973S possibly damaging Het
Or4f62 G A 2: 111,986,787 (GRCm39) V164I probably benign Het
Or51a43 G A 7: 103,717,675 (GRCm39) R188* probably null Het
Or6c212 T C 10: 129,558,652 (GRCm39) I254V probably benign Het
Or9g19 A T 2: 85,600,322 (GRCm39) Y59F probably damaging Het
Pkdrej C A 15: 85,701,773 (GRCm39) E1388* probably null Het
Prrc2b T A 2: 32,106,067 (GRCm39) D1482E probably benign Het
Relch C T 1: 105,673,851 (GRCm39) S1080L possibly damaging Het
Sppl2a A T 2: 126,754,615 (GRCm39) S403R possibly damaging Het
Tespa1 A G 10: 130,197,944 (GRCm39) D322G probably damaging Het
Ttn T C 2: 76,644,517 (GRCm39) N13079S possibly damaging Het
Wdr53 A G 16: 32,071,008 (GRCm39) I118V probably benign Het
Zdbf2 T C 1: 63,344,774 (GRCm39) M1051T probably benign Het
Zfp784 G C 7: 5,041,357 (GRCm39) probably benign Het
Other mutations in Tmcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Tmcc2 APN 1 132,308,436 (GRCm39) missense probably benign
IGL01991:Tmcc2 APN 1 132,288,830 (GRCm39) missense probably benign 0.25
IGL02259:Tmcc2 APN 1 132,288,898 (GRCm39) missense probably benign
IGL02310:Tmcc2 APN 1 132,286,645 (GRCm39) missense probably damaging 1.00
IGL02551:Tmcc2 APN 1 132,285,317 (GRCm39) missense probably damaging 1.00
IGL03301:Tmcc2 APN 1 132,288,557 (GRCm39) missense possibly damaging 0.95
IGL03347:Tmcc2 APN 1 132,285,390 (GRCm39) missense probably damaging 1.00
R0131:Tmcc2 UTSW 1 132,308,444 (GRCm39) missense probably benign 0.10
R0233:Tmcc2 UTSW 1 132,288,389 (GRCm39) missense probably damaging 0.99
R0233:Tmcc2 UTSW 1 132,288,389 (GRCm39) missense probably damaging 0.99
R1146:Tmcc2 UTSW 1 132,285,493 (GRCm39) small deletion probably benign
R1146:Tmcc2 UTSW 1 132,285,493 (GRCm39) small deletion probably benign
R1538:Tmcc2 UTSW 1 132,308,718 (GRCm39) missense probably damaging 0.98
R3907:Tmcc2 UTSW 1 132,288,376 (GRCm39) missense probably damaging 1.00
R4890:Tmcc2 UTSW 1 132,308,517 (GRCm39) missense probably benign 0.43
R5364:Tmcc2 UTSW 1 132,285,534 (GRCm39) missense probably damaging 1.00
R5567:Tmcc2 UTSW 1 132,285,543 (GRCm39) missense probably benign 0.01
R5596:Tmcc2 UTSW 1 132,288,221 (GRCm39) missense probably damaging 1.00
R5916:Tmcc2 UTSW 1 132,285,429 (GRCm39) missense probably damaging 0.98
R5931:Tmcc2 UTSW 1 132,285,493 (GRCm39) small deletion probably benign
R6278:Tmcc2 UTSW 1 132,286,720 (GRCm39) missense probably damaging 0.99
R7404:Tmcc2 UTSW 1 132,288,759 (GRCm39) missense probably damaging 0.98
R7806:Tmcc2 UTSW 1 132,288,527 (GRCm39) missense probably damaging 1.00
R7848:Tmcc2 UTSW 1 132,288,359 (GRCm39) missense probably damaging 1.00
R7903:Tmcc2 UTSW 1 132,288,199 (GRCm39) missense probably benign 0.00
R9458:Tmcc2 UTSW 1 132,286,747 (GRCm39) missense probably damaging 1.00
RF012:Tmcc2 UTSW 1 132,288,756 (GRCm39) missense probably damaging 1.00
X0052:Tmcc2 UTSW 1 132,288,071 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTTCCATGGGGTCCTTCAGG -3'
(R):5'- CCTGAAGCTGGCCAACAATG -3'

Sequencing Primer
(F):5'- ACTGCCGAACTTGTTGCGAATG -3'
(R):5'- TGGCCAACAATGCGGAC -3'
Posted On 2014-11-12