Incidental Mutation 'R2428:Tmcc2'
ID250294
Institutional Source Beutler Lab
Gene Symbol Tmcc2
Ensembl Gene ENSMUSG00000042066
Gene Nametransmembrane and coiled-coil domains 2
Synonyms1110063G11Rik
MMRRC Submission 040390-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R2428 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132356315-132391281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 132360831 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 373 (V373M)
Ref Sequence ENSEMBL: ENSMUSP00000038369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045473] [ENSMUST00000132435] [ENSMUST00000142609]
Predicted Effect probably damaging
Transcript: ENSMUST00000045473
AA Change: V373M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038369
Gene: ENSMUSG00000042066
AA Change: V373M

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 100 112 N/A INTRINSIC
low complexity region 164 183 N/A INTRINSIC
low complexity region 253 267 N/A INTRINSIC
Pfam:Tmemb_cc2 283 694 6.3e-178 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125439
Predicted Effect probably damaging
Transcript: ENSMUST00000132435
AA Change: V295M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118844
Gene: ENSMUSG00000042066
AA Change: V295M

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 86 105 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
Pfam:Tmemb_cc2 203 617 1.1e-193 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138717
Predicted Effect possibly damaging
Transcript: ENSMUST00000142609
AA Change: V138M

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115721
Gene: ENSMUSG00000042066
AA Change: V138M

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:Tmemb_cc2 46 460 2.2e-194 PFAM
Meta Mutation Damage Score 0.1446 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,746,126 S1080L possibly damaging Het
Acad9 G A 3: 36,090,923 A624T probably benign Het
Astn1 C T 1: 158,612,346 A828V possibly damaging Het
Bag6 A C 17: 35,147,175 D1117A probably damaging Het
Col12a1 A T 9: 79,602,251 C3042S probably benign Het
Ctc1 G A 11: 69,027,701 V265I possibly damaging Het
Cubn T C 2: 13,476,150 Y298C probably damaging Het
Dmtn G A 14: 70,613,403 R183W probably damaging Het
F2rl2 T A 13: 95,697,077 I5N possibly damaging Het
Gpr137c A G 14: 45,278,963 Y336C probably damaging Het
Gstm6 T A 3: 107,943,606 I10F possibly damaging Het
Hivep3 T A 4: 120,098,508 C1340* probably null Het
Igf1 A G 10: 87,864,821 T36A probably damaging Het
Lrch1 T A 14: 74,807,545 probably benign Het
Mrpl40 A T 16: 18,872,375 I195N probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ndufc1 A C 3: 51,408,143 probably null Het
Nfasc T C 1: 132,595,654 N973S possibly damaging Het
Olfr1013 A T 2: 85,769,978 Y59F probably damaging Het
Olfr1318 G A 2: 112,156,442 V164I probably benign Het
Olfr644 G A 7: 104,068,468 R188* probably null Het
Olfr805 T C 10: 129,722,783 I254V probably benign Het
Pkdrej C A 15: 85,817,572 E1388* probably null Het
Prrc2b T A 2: 32,216,055 D1482E probably benign Het
Sppl2a A T 2: 126,912,695 S403R possibly damaging Het
Tespa1 A G 10: 130,362,075 D322G probably damaging Het
Ttn T C 2: 76,814,173 N13079S possibly damaging Het
Wdr53 A G 16: 32,252,190 I118V probably benign Het
Zdbf2 T C 1: 63,305,615 M1051T probably benign Het
Zfp784 G C 7: 5,038,358 probably benign Het
Other mutations in Tmcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Tmcc2 APN 1 132380698 missense probably benign
IGL01991:Tmcc2 APN 1 132361092 missense probably benign 0.25
IGL02259:Tmcc2 APN 1 132361160 missense probably benign
IGL02310:Tmcc2 APN 1 132358907 missense probably damaging 1.00
IGL02551:Tmcc2 APN 1 132357579 missense probably damaging 1.00
IGL03301:Tmcc2 APN 1 132360819 missense possibly damaging 0.95
IGL03347:Tmcc2 APN 1 132357652 missense probably damaging 1.00
R0131:Tmcc2 UTSW 1 132380706 missense probably benign 0.10
R0233:Tmcc2 UTSW 1 132360651 missense probably damaging 0.99
R0233:Tmcc2 UTSW 1 132360651 missense probably damaging 0.99
R1146:Tmcc2 UTSW 1 132357755 small deletion probably benign
R1146:Tmcc2 UTSW 1 132357755 small deletion probably benign
R1538:Tmcc2 UTSW 1 132380980 missense probably damaging 0.98
R3907:Tmcc2 UTSW 1 132360638 missense probably damaging 1.00
R4890:Tmcc2 UTSW 1 132380779 missense probably benign 0.43
R5364:Tmcc2 UTSW 1 132357796 missense probably damaging 1.00
R5567:Tmcc2 UTSW 1 132357805 missense probably benign 0.01
R5596:Tmcc2 UTSW 1 132360483 missense probably damaging 1.00
R5916:Tmcc2 UTSW 1 132357691 missense probably damaging 0.98
R5931:Tmcc2 UTSW 1 132357755 small deletion probably benign
R6278:Tmcc2 UTSW 1 132358982 missense probably damaging 0.99
R7404:Tmcc2 UTSW 1 132361021 missense probably damaging 0.98
R7806:Tmcc2 UTSW 1 132360789 missense probably damaging 1.00
R7848:Tmcc2 UTSW 1 132360621 missense probably damaging 1.00
R7903:Tmcc2 UTSW 1 132360461 missense probably benign 0.00
R7931:Tmcc2 UTSW 1 132360621 missense probably damaging 1.00
R7986:Tmcc2 UTSW 1 132360461 missense probably benign 0.00
RF012:Tmcc2 UTSW 1 132361018 missense probably damaging 1.00
X0052:Tmcc2 UTSW 1 132360333 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTTCCATGGGGTCCTTCAGG -3'
(R):5'- CCTGAAGCTGGCCAACAATG -3'

Sequencing Primer
(F):5'- ACTGCCGAACTTGTTGCGAATG -3'
(R):5'- TGGCCAACAATGCGGAC -3'
Posted On2014-11-12