Incidental Mutation 'R2428:Olfr1013'
ID250300
Institutional Source Beutler Lab
Gene Symbol Olfr1013
Ensembl Gene ENSMUSG00000053287
Gene Nameolfactory receptor 1013
SynonymsMOR213-2, GA_x6K02T2Q125-47248551-47249468
MMRRC Submission 040390-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R2428 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85767098-85774649 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85769978 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 59 (Y59F)
Ref Sequence ENSEMBL: ENSMUSP00000150201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065626] [ENSMUST00000213453] [ENSMUST00000216397]
Predicted Effect probably damaging
Transcript: ENSMUST00000065626
AA Change: Y59F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068173
Gene: ENSMUSG00000053287
AA Change: Y59F

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 3.3e-50 PFAM
Pfam:7tm_1 40 289 1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213453
Predicted Effect probably damaging
Transcript: ENSMUST00000216397
AA Change: Y59F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1922 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,746,126 S1080L possibly damaging Het
Acad9 G A 3: 36,090,923 A624T probably benign Het
Astn1 C T 1: 158,612,346 A828V possibly damaging Het
Bag6 A C 17: 35,147,175 D1117A probably damaging Het
Col12a1 A T 9: 79,602,251 C3042S probably benign Het
Ctc1 G A 11: 69,027,701 V265I possibly damaging Het
Cubn T C 2: 13,476,150 Y298C probably damaging Het
Dmtn G A 14: 70,613,403 R183W probably damaging Het
F2rl2 T A 13: 95,697,077 I5N possibly damaging Het
Gpr137c A G 14: 45,278,963 Y336C probably damaging Het
Gstm6 T A 3: 107,943,606 I10F possibly damaging Het
Hivep3 T A 4: 120,098,508 C1340* probably null Het
Igf1 A G 10: 87,864,821 T36A probably damaging Het
Lrch1 T A 14: 74,807,545 probably benign Het
Mrpl40 A T 16: 18,872,375 I195N probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ndufc1 A C 3: 51,408,143 probably null Het
Nfasc T C 1: 132,595,654 N973S possibly damaging Het
Olfr1318 G A 2: 112,156,442 V164I probably benign Het
Olfr644 G A 7: 104,068,468 R188* probably null Het
Olfr805 T C 10: 129,722,783 I254V probably benign Het
Pkdrej C A 15: 85,817,572 E1388* probably null Het
Prrc2b T A 2: 32,216,055 D1482E probably benign Het
Sppl2a A T 2: 126,912,695 S403R possibly damaging Het
Tespa1 A G 10: 130,362,075 D322G probably damaging Het
Tmcc2 C T 1: 132,360,831 V373M probably damaging Het
Ttn T C 2: 76,814,173 N13079S possibly damaging Het
Wdr53 A G 16: 32,252,190 I118V probably benign Het
Zdbf2 T C 1: 63,305,615 M1051T probably benign Het
Zfp784 G C 7: 5,038,358 probably benign Het
Other mutations in Olfr1013
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01944:Olfr1013 APN 2 85770040 missense probably damaging 0.99
R0523:Olfr1013 UTSW 2 85769929 missense probably benign
R0939:Olfr1013 UTSW 2 85770653 nonsense probably null
R1400:Olfr1013 UTSW 2 85770133 missense possibly damaging 0.87
R1710:Olfr1013 UTSW 2 85769855 missense probably benign 0.32
R2150:Olfr1013 UTSW 2 85769998 missense probably damaging 1.00
R4730:Olfr1013 UTSW 2 85770061 nonsense probably null
R5101:Olfr1013 UTSW 2 85769924 missense probably damaging 0.97
R5632:Olfr1013 UTSW 2 85770269 missense probably benign
R5849:Olfr1013 UTSW 2 85770424 missense probably benign 0.00
R6175:Olfr1013 UTSW 2 85770308 missense probably benign 0.07
R6454:Olfr1013 UTSW 2 85770373 missense probably benign 0.03
R8032:Olfr1013 UTSW 2 85769866 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCATTTCATATAGCCATGGATCAG -3'
(R):5'- TGGCTTTGAAATAGCCACATAGC -3'

Sequencing Primer
(F):5'- ACAGAAGGTCCTGTTTGC -3'
(R):5'- CATAGCGGTCATAAGCCATGGC -3'
Posted On2014-11-12