Incidental Mutation 'R2428:Olfr1318'
ID 250301
Institutional Source Beutler Lab
Gene Symbol Olfr1318
Ensembl Gene ENSMUSG00000049758
Gene Name olfactory receptor 1318
Synonyms MOR245-16, GA_x6K02T2Q125-73202172-73203134
MMRRC Submission 040390-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R2428 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 112154198-112159157 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 112156442 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 164 (V164I)
Ref Sequence ENSEMBL: ENSMUSP00000151164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058176] [ENSMUST00000214063] [ENSMUST00000217533]
AlphaFold Q7TQW6
Predicted Effect probably benign
Transcript: ENSMUST00000058176
AA Change: V164I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000051938
Gene: ENSMUSG00000049758
AA Change: V164I

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 2.4e-39 PFAM
Pfam:7tm_1 41 287 1.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214063
AA Change: V164I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216873
Predicted Effect probably benign
Transcript: ENSMUST00000217533
AA Change: V164I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,746,126 S1080L possibly damaging Het
Acad9 G A 3: 36,090,923 A624T probably benign Het
Astn1 C T 1: 158,612,346 A828V possibly damaging Het
Bag6 A C 17: 35,147,175 D1117A probably damaging Het
Col12a1 A T 9: 79,602,251 C3042S probably benign Het
Ctc1 G A 11: 69,027,701 V265I possibly damaging Het
Cubn T C 2: 13,476,150 Y298C probably damaging Het
Dmtn G A 14: 70,613,403 R183W probably damaging Het
F2rl2 T A 13: 95,697,077 I5N possibly damaging Het
Gpr137c A G 14: 45,278,963 Y336C probably damaging Het
Gstm6 T A 3: 107,943,606 I10F possibly damaging Het
Hivep3 T A 4: 120,098,508 C1340* probably null Het
Igf1 A G 10: 87,864,821 T36A probably damaging Het
Lrch1 T A 14: 74,807,545 probably benign Het
Mrpl40 A T 16: 18,872,375 I195N probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ndufc1 A C 3: 51,408,143 probably null Het
Nfasc T C 1: 132,595,654 N973S possibly damaging Het
Olfr1013 A T 2: 85,769,978 Y59F probably damaging Het
Olfr644 G A 7: 104,068,468 R188* probably null Het
Olfr805 T C 10: 129,722,783 I254V probably benign Het
Pkdrej C A 15: 85,817,572 E1388* probably null Het
Prrc2b T A 2: 32,216,055 D1482E probably benign Het
Sppl2a A T 2: 126,912,695 S403R possibly damaging Het
Tespa1 A G 10: 130,362,075 D322G probably damaging Het
Tmcc2 C T 1: 132,360,831 V373M probably damaging Het
Ttn T C 2: 76,814,173 N13079S possibly damaging Het
Wdr53 A G 16: 32,252,190 I118V probably benign Het
Zdbf2 T C 1: 63,305,615 M1051T probably benign Het
Zfp784 G C 7: 5,038,358 probably benign Het
Other mutations in Olfr1318
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Olfr1318 APN 2 112156067 missense probably benign
IGL00923:Olfr1318 APN 2 112156777 missense possibly damaging 0.75
IGL02800:Olfr1318 APN 2 112156244 missense possibly damaging 0.95
R0012:Olfr1318 UTSW 2 112156826 missense possibly damaging 0.84
R1614:Olfr1318 UTSW 2 112156517 missense probably damaging 1.00
R1989:Olfr1318 UTSW 2 112156377 missense probably benign 0.00
R2963:Olfr1318 UTSW 2 112156459 nonsense probably null
R4868:Olfr1318 UTSW 2 112156571 missense probably damaging 0.99
R4960:Olfr1318 UTSW 2 112156352 missense probably benign 0.00
R5121:Olfr1318 UTSW 2 112156286 missense possibly damaging 0.47
R6218:Olfr1318 UTSW 2 112156356 missense probably damaging 0.99
R6294:Olfr1318 UTSW 2 112156019 missense probably benign
R6350:Olfr1318 UTSW 2 112156197 missense probably damaging 0.99
R6515:Olfr1318 UTSW 2 112156365 missense probably benign 0.00
R6722:Olfr1318 UTSW 2 112156882 missense probably benign
R6829:Olfr1318 UTSW 2 112155794 intron probably benign
R7186:Olfr1318 UTSW 2 112156162 missense probably damaging 1.00
R7206:Olfr1318 UTSW 2 112156459 missense probably damaging 1.00
R7444:Olfr1318 UTSW 2 112156715 missense probably damaging 1.00
R8293:Olfr1318 UTSW 2 112156253 missense probably benign 0.07
R8474:Olfr1318 UTSW 2 112155975 missense probably benign
R8712:Olfr1318 UTSW 2 112156589 missense probably damaging 1.00
R8749:Olfr1318 UTSW 2 112156524 missense possibly damaging 0.60
R8888:Olfr1318 UTSW 2 112156629 missense probably benign 0.00
R9223:Olfr1318 UTSW 2 112156128 missense possibly damaging 0.58
R9406:Olfr1318 UTSW 2 112156298 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCCTTGAACGGATGCATCAC -3'
(R):5'- AGTGTTTACGAACTGTGACCAG -3'

Sequencing Primer
(F):5'- GATGTTCTTCATCCACACTGTTGGG -3'
(R):5'- TTTACGAACTGTGACCAGAATGAAG -3'
Posted On 2014-11-12