Incidental Mutation 'R2428:Ndufc1'
ID 250304
Institutional Source Beutler Lab
Gene Symbol Ndufc1
Ensembl Gene ENSMUSG00000037152
Gene Name NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1
Synonyms
MMRRC Submission 040390-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock # R2428 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 51404677-51408988 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 51408143 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038108] [ENSMUST00000193279] [ENSMUST00000193279]
AlphaFold Q9CQY9
Predicted Effect probably null
Transcript: ENSMUST00000038108
SMART Domains Protein: ENSMUSP00000038463
Gene: ENSMUSG00000037152

DomainStartEndE-ValueType
Pfam:NADH_dh_m_C1 28 76 3.1e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145572
Predicted Effect probably null
Transcript: ENSMUST00000193279
SMART Domains Protein: ENSMUSP00000141933
Gene: ENSMUSG00000037152

DomainStartEndE-ValueType
Pfam:NADH_dh_m_C1 28 76 3.7e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000193279
SMART Domains Protein: ENSMUSP00000141933
Gene: ENSMUSG00000037152

DomainStartEndE-ValueType
Pfam:NADH_dh_m_C1 28 76 3.7e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194242
Meta Mutation Damage Score 0.9490 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The encoded protein is a subunit of the NADH:ubiquinone oxidoreductase (complex I), the first enzyme complex in the electron transport chain located in the inner mitochondrial membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,746,126 S1080L possibly damaging Het
Acad9 G A 3: 36,090,923 A624T probably benign Het
Astn1 C T 1: 158,612,346 A828V possibly damaging Het
Bag6 A C 17: 35,147,175 D1117A probably damaging Het
Col12a1 A T 9: 79,602,251 C3042S probably benign Het
Ctc1 G A 11: 69,027,701 V265I possibly damaging Het
Cubn T C 2: 13,476,150 Y298C probably damaging Het
Dmtn G A 14: 70,613,403 R183W probably damaging Het
F2rl2 T A 13: 95,697,077 I5N possibly damaging Het
Gpr137c A G 14: 45,278,963 Y336C probably damaging Het
Gstm6 T A 3: 107,943,606 I10F possibly damaging Het
Hivep3 T A 4: 120,098,508 C1340* probably null Het
Igf1 A G 10: 87,864,821 T36A probably damaging Het
Lrch1 T A 14: 74,807,545 probably benign Het
Mrpl40 A T 16: 18,872,375 I195N probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Nfasc T C 1: 132,595,654 N973S possibly damaging Het
Olfr1013 A T 2: 85,769,978 Y59F probably damaging Het
Olfr1318 G A 2: 112,156,442 V164I probably benign Het
Olfr644 G A 7: 104,068,468 R188* probably null Het
Olfr805 T C 10: 129,722,783 I254V probably benign Het
Pkdrej C A 15: 85,817,572 E1388* probably null Het
Prrc2b T A 2: 32,216,055 D1482E probably benign Het
Sppl2a A T 2: 126,912,695 S403R possibly damaging Het
Tespa1 A G 10: 130,362,075 D322G probably damaging Het
Tmcc2 C T 1: 132,360,831 V373M probably damaging Het
Ttn T C 2: 76,814,173 N13079S possibly damaging Het
Wdr53 A G 16: 32,252,190 I118V probably benign Het
Zdbf2 T C 1: 63,305,615 M1051T probably benign Het
Zfp784 G C 7: 5,038,358 probably benign Het
Other mutations in Ndufc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Ndufc1 APN 3 51407376 missense possibly damaging 0.91
R1639:Ndufc1 UTSW 3 51408243 missense probably benign
R1642:Ndufc1 UTSW 3 51408243 missense probably benign
R1643:Ndufc1 UTSW 3 51408243 missense probably benign
R1926:Ndufc1 UTSW 3 51407395 missense probably benign 0.01
R8433:Ndufc1 UTSW 3 51408890 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCAGCAATTAAGCCTTCCATC -3'
(R):5'- ACTCTTTAAATTGGGGACGAACAG -3'

Sequencing Primer
(F):5'- TCCATCAGGAAAAACTTTCAAAAATG -3'
(R):5'- ATCAGGAATTCAGGGCCAGCC -3'
Posted On 2014-11-12