Incidental Mutation 'R2428:Gstm6'
ID250305
Institutional Source Beutler Lab
Gene Symbol Gstm6
Ensembl Gene ENSMUSG00000068762
Gene Nameglutathione S-transferase, mu 6
Synonyms
MMRRC Submission 040390-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2428 (G1)
Quality Score182
Status Validated
Chromosome3
Chromosomal Location107938847-107943749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107943606 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 10 (I10F)
Ref Sequence ENSEMBL: ENSMUSP00000102296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106681] [ENSMUST00000106683] [ENSMUST00000106684] [ENSMUST00000106685] [ENSMUST00000155926]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106680
SMART Domains Protein: ENSMUSP00000102291
Gene: ENSMUSG00000068762

DomainStartEndE-ValueType
Pfam:GST_N 3 77 6.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106681
SMART Domains Protein: ENSMUSP00000102292
Gene: ENSMUSG00000068762

DomainStartEndE-ValueType
Pfam:GST_N 1 48 9.4e-12 PFAM
Pfam:GST_C_3 7 154 7.6e-11 PFAM
Pfam:GST_C 70 154 3.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106683
SMART Domains Protein: ENSMUSP00000102294
Gene: ENSMUSG00000068762

DomainStartEndE-ValueType
Pfam:GST_C_3 4 95 6.3e-11 PFAM
Pfam:GST_C 6 97 2.1e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106684
AA Change: I10F

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102295
Gene: ENSMUSG00000068762
AA Change: I10F

DomainStartEndE-ValueType
Pfam:GST_N 3 82 2e-22 PFAM
Pfam:GST_C_3 41 204 4.1e-12 PFAM
Pfam:GST_C 104 205 5.9e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106685
AA Change: I10F

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102296
Gene: ENSMUSG00000068762
AA Change: I10F

DomainStartEndE-ValueType
Pfam:GST_N 3 82 7.9e-23 PFAM
Pfam:GST_C 104 192 8.4e-20 PFAM
Pfam:GST_C_3 113 190 6.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155926
SMART Domains Protein: ENSMUSP00000139500
Gene: ENSMUSG00000068762

DomainStartEndE-ValueType
Pfam:GST_N 1 48 1.9e-10 PFAM
Meta Mutation Damage Score 0.7019 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,746,126 S1080L possibly damaging Het
Acad9 G A 3: 36,090,923 A624T probably benign Het
Astn1 C T 1: 158,612,346 A828V possibly damaging Het
Bag6 A C 17: 35,147,175 D1117A probably damaging Het
Col12a1 A T 9: 79,602,251 C3042S probably benign Het
Ctc1 G A 11: 69,027,701 V265I possibly damaging Het
Cubn T C 2: 13,476,150 Y298C probably damaging Het
Dmtn G A 14: 70,613,403 R183W probably damaging Het
F2rl2 T A 13: 95,697,077 I5N possibly damaging Het
Gpr137c A G 14: 45,278,963 Y336C probably damaging Het
Hivep3 T A 4: 120,098,508 C1340* probably null Het
Igf1 A G 10: 87,864,821 T36A probably damaging Het
Lrch1 T A 14: 74,807,545 probably benign Het
Mrpl40 A T 16: 18,872,375 I195N probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ndufc1 A C 3: 51,408,143 probably null Het
Nfasc T C 1: 132,595,654 N973S possibly damaging Het
Olfr1013 A T 2: 85,769,978 Y59F probably damaging Het
Olfr1318 G A 2: 112,156,442 V164I probably benign Het
Olfr644 G A 7: 104,068,468 R188* probably null Het
Olfr805 T C 10: 129,722,783 I254V probably benign Het
Pkdrej C A 15: 85,817,572 E1388* probably null Het
Prrc2b T A 2: 32,216,055 D1482E probably benign Het
Sppl2a A T 2: 126,912,695 S403R possibly damaging Het
Tespa1 A G 10: 130,362,075 D322G probably damaging Het
Tmcc2 C T 1: 132,360,831 V373M probably damaging Het
Ttn T C 2: 76,814,173 N13079S possibly damaging Het
Wdr53 A G 16: 32,252,190 I118V probably benign Het
Zdbf2 T C 1: 63,305,615 M1051T probably benign Het
Zfp784 G C 7: 5,038,358 probably benign Het
Other mutations in Gstm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Gstm6 APN 3 107941063 missense probably benign 0.15
IGL02100:Gstm6 APN 3 107942337 missense probably benign 0.20
IGL02685:Gstm6 APN 3 107941191 missense probably benign 0.25
R1221:Gstm6 UTSW 3 107941102 missense probably damaging 1.00
R2763:Gstm6 UTSW 3 107941042 missense possibly damaging 0.65
R6178:Gstm6 UTSW 3 107941081 missense probably benign 0.01
R6545:Gstm6 UTSW 3 107942365 missense probably damaging 1.00
R6730:Gstm6 UTSW 3 107942725 nonsense probably null
R8240:Gstm6 UTSW 3 107942137 missense probably damaging 0.99
X0018:Gstm6 UTSW 3 107942747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGACAGAGTTTGGACTG -3'
(R):5'- GCCTTCGGTATCTGAAAGCTC -3'

Sequencing Primer
(F):5'- GGGAATCTTCTTCGTGGA -3'
(R):5'- CGGATGATAGCTCCTGGAATTAG -3'
Posted On2014-11-12