Incidental Mutation 'R2428:Zfp784'
ID 250309
Institutional Source Beutler Lab
Gene Symbol Zfp784
Ensembl Gene ENSMUSG00000043290
Gene Name zinc finger protein 784
Synonyms
MMRRC Submission 040390-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock # R2428 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 5034439-5038446 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) G to C at 5038358 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062428] [ENSMUST00000076251] [ENSMUST00000076791] [ENSMUST00000208728]
AlphaFold Q8BI69
Predicted Effect unknown
Transcript: ENSMUST00000062428
AA Change: P19A
SMART Domains Protein: ENSMUSP00000051979
Gene: ENSMUSG00000043290
AA Change: P19A

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
ZnF_C2H2 64 86 1.02e1 SMART
ZnF_C2H2 100 122 9.96e-1 SMART
ZnF_C2H2 128 150 6.67e-2 SMART
low complexity region 180 192 N/A INTRINSIC
ZnF_C2H2 195 217 4.11e-2 SMART
ZnF_C2H2 223 245 7.26e-3 SMART
ZnF_C2H2 251 273 3.21e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076251
SMART Domains Protein: ENSMUSP00000075601
Gene: ENSMUSG00000074405

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
low complexity region 120 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
ZnF_C2H2 220 242 1.28e-3 SMART
ZnF_C2H2 248 270 5.5e-3 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 294 324 N/A INTRINSIC
ZnF_C2H2 350 372 8.81e-2 SMART
ZnF_C2H2 378 400 6.08e-5 SMART
ZnF_C2H2 407 429 1.79e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 478 495 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 523 542 N/A INTRINSIC
ZnF_C2H2 546 568 4.47e-3 SMART
ZnF_C2H2 574 596 5.42e-2 SMART
ZnF_C2H2 602 624 1.72e-4 SMART
low complexity region 628 660 N/A INTRINSIC
ZnF_C2H2 664 686 5.34e-1 SMART
ZnF_C2H2 692 714 2.82e0 SMART
low complexity region 725 745 N/A INTRINSIC
low complexity region 750 770 N/A INTRINSIC
low complexity region 772 788 N/A INTRINSIC
ZnF_C2H2 791 813 1.64e-1 SMART
ZnF_C2H2 819 841 9.3e-1 SMART
ZnF_C2H2 847 869 2.95e-3 SMART
ZnF_C2H2 875 897 3.83e-2 SMART
ZnF_C2H2 903 925 2.05e-2 SMART
ZnF_C2H2 931 953 1.18e-2 SMART
ZnF_C2H2 959 981 1.36e-2 SMART
ZnF_C2H2 988 1010 5.06e-2 SMART
ZnF_C2H2 1016 1038 4.72e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076791
Predicted Effect probably benign
Transcript: ENSMUST00000208728
Meta Mutation Damage Score 0.1535 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,746,126 S1080L possibly damaging Het
Acad9 G A 3: 36,090,923 A624T probably benign Het
Astn1 C T 1: 158,612,346 A828V possibly damaging Het
Bag6 A C 17: 35,147,175 D1117A probably damaging Het
Col12a1 A T 9: 79,602,251 C3042S probably benign Het
Ctc1 G A 11: 69,027,701 V265I possibly damaging Het
Cubn T C 2: 13,476,150 Y298C probably damaging Het
Dmtn G A 14: 70,613,403 R183W probably damaging Het
F2rl2 T A 13: 95,697,077 I5N possibly damaging Het
Gpr137c A G 14: 45,278,963 Y336C probably damaging Het
Gstm6 T A 3: 107,943,606 I10F possibly damaging Het
Hivep3 T A 4: 120,098,508 C1340* probably null Het
Igf1 A G 10: 87,864,821 T36A probably damaging Het
Lrch1 T A 14: 74,807,545 probably benign Het
Mrpl40 A T 16: 18,872,375 I195N probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ndufc1 A C 3: 51,408,143 probably null Het
Nfasc T C 1: 132,595,654 N973S possibly damaging Het
Olfr1013 A T 2: 85,769,978 Y59F probably damaging Het
Olfr1318 G A 2: 112,156,442 V164I probably benign Het
Olfr644 G A 7: 104,068,468 R188* probably null Het
Olfr805 T C 10: 129,722,783 I254V probably benign Het
Pkdrej C A 15: 85,817,572 E1388* probably null Het
Prrc2b T A 2: 32,216,055 D1482E probably benign Het
Sppl2a A T 2: 126,912,695 S403R possibly damaging Het
Tespa1 A G 10: 130,362,075 D322G probably damaging Het
Tmcc2 C T 1: 132,360,831 V373M probably damaging Het
Ttn T C 2: 76,814,173 N13079S possibly damaging Het
Wdr53 A G 16: 32,252,190 I118V probably benign Het
Zdbf2 T C 1: 63,305,615 M1051T probably benign Het
Other mutations in Zfp784
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Zfp784 APN 7 5036037 intron probably benign
IGL02239:Zfp784 APN 7 5035671 intron probably benign
IGL03333:Zfp784 APN 7 5036352 intron probably benign
R1464:Zfp784 UTSW 7 5035801 missense possibly damaging 0.71
R1464:Zfp784 UTSW 7 5035801 missense possibly damaging 0.71
R1515:Zfp784 UTSW 7 5036040 intron probably benign
R1604:Zfp784 UTSW 7 5036454 intron probably benign
R1606:Zfp784 UTSW 7 5035775 missense possibly damaging 0.85
R1723:Zfp784 UTSW 7 5035783 missense possibly damaging 0.71
R2680:Zfp784 UTSW 7 5036117 missense possibly damaging 0.86
R8083:Zfp784 UTSW 7 5035906 missense possibly damaging 0.53
R8143:Zfp784 UTSW 7 5035911 missense possibly damaging 0.93
R9382:Zfp784 UTSW 7 5038339 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGCTGTCTTCAAGACCCG -3'
(R):5'- AAGACCTTTTGCCGGATTCC -3'

Sequencing Primer
(F):5'- TGTCTTCAAGACCCGCCTCAAC -3'
(R):5'- GCCGGATTCCGCCTATC -3'
Posted On 2014-11-12