Incidental Mutation 'R2428:Igf1'
ID 250313
Institutional Source Beutler Lab
Gene Symbol Igf1
Ensembl Gene ENSMUSG00000020053
Gene Name insulin-like growth factor 1
Synonyms C730016P09Rik, Igf-I, Igf-1
MMRRC Submission 040390-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2428 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 87858265-87937042 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87864821 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 36 (T36A)
Ref Sequence ENSEMBL: ENSMUSP00000122188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062862] [ENSMUST00000095360] [ENSMUST00000105300] [ENSMUST00000121161] [ENSMUST00000121952] [ENSMUST00000122100] [ENSMUST00000122386] [ENSMUST00000126490]
AlphaFold P05017
Predicted Effect probably damaging
Transcript: ENSMUST00000062862
AA Change: T36A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056668
Gene: ENSMUSG00000020053
AA Change: T36A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095360
AA Change: T52A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093005
Gene: ENSMUSG00000020053
AA Change: T52A

DomainStartEndE-ValueType
IlGF 51 109 9.22e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105300
AA Change: T52A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000100937
Gene: ENSMUSG00000020053
AA Change: T52A

DomainStartEndE-ValueType
IlGF 51 109 9.22e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121161
AA Change: T36A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114120
Gene: ENSMUSG00000020053
AA Change: T36A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121952
AA Change: T36A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113177
Gene: ENSMUSG00000020053
AA Change: T36A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122100
AA Change: T36A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112878
Gene: ENSMUSG00000020053
AA Change: T36A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122386
AA Change: T52A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113905
Gene: ENSMUSG00000020053
AA Change: T52A

DomainStartEndE-ValueType
IlGF 51 109 9.22e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126490
AA Change: T36A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122188
Gene: ENSMUSG00000020053
AA Change: T36A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146581
Meta Mutation Damage Score 0.5902 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: This gene encodes a member of the insulin-like growth factor (IGF) family of proteins that promote growth and development during fetal and postnatal life. This gene is predominantly expressed in the liver and the encoded protein undergoes proteolytic processing to generate a disulfide-linked mature polypeptide. Transgenic disruption of this gene in mice results in reduced postnatal survival and severe growth retardation. Mice lacking the encoded protein exhibit generalized organ hypoplasia including underdevelopment of the central nervous system and developmental defects in bone, muscle and reproductive systems. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants are severely growth retarded and die perinatally with many immature organ systems. Heterozygotes and partial knockouts show genetic background effects and can display growth retardation and abnormalities in muscle, lungs, and CNS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,746,126 S1080L possibly damaging Het
Acad9 G A 3: 36,090,923 A624T probably benign Het
Astn1 C T 1: 158,612,346 A828V possibly damaging Het
Bag6 A C 17: 35,147,175 D1117A probably damaging Het
Col12a1 A T 9: 79,602,251 C3042S probably benign Het
Ctc1 G A 11: 69,027,701 V265I possibly damaging Het
Cubn T C 2: 13,476,150 Y298C probably damaging Het
Dmtn G A 14: 70,613,403 R183W probably damaging Het
F2rl2 T A 13: 95,697,077 I5N possibly damaging Het
Gpr137c A G 14: 45,278,963 Y336C probably damaging Het
Gstm6 T A 3: 107,943,606 I10F possibly damaging Het
Hivep3 T A 4: 120,098,508 C1340* probably null Het
Lrch1 T A 14: 74,807,545 probably benign Het
Mrpl40 A T 16: 18,872,375 I195N probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ndufc1 A C 3: 51,408,143 probably null Het
Nfasc T C 1: 132,595,654 N973S possibly damaging Het
Olfr1013 A T 2: 85,769,978 Y59F probably damaging Het
Olfr1318 G A 2: 112,156,442 V164I probably benign Het
Olfr644 G A 7: 104,068,468 R188* probably null Het
Olfr805 T C 10: 129,722,783 I254V probably benign Het
Pkdrej C A 15: 85,817,572 E1388* probably null Het
Prrc2b T A 2: 32,216,055 D1482E probably benign Het
Sppl2a A T 2: 126,912,695 S403R possibly damaging Het
Tespa1 A G 10: 130,362,075 D322G probably damaging Het
Tmcc2 C T 1: 132,360,831 V373M probably damaging Het
Ttn T C 2: 76,814,173 N13079S possibly damaging Het
Wdr53 A G 16: 32,252,190 I118V probably benign Het
Zdbf2 T C 1: 63,305,615 M1051T probably benign Het
Zfp784 G C 7: 5,038,358 probably benign Het
Other mutations in Igf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02485:Igf1 APN 10 87864746 missense probably benign
IGL03171:Igf1 APN 10 87864821 missense probably damaging 1.00
R1850:Igf1 UTSW 10 87861374 missense possibly damaging 0.47
R1962:Igf1 UTSW 10 87864864 missense probably damaging 1.00
R3852:Igf1 UTSW 10 87915319 nonsense probably null
R4757:Igf1 UTSW 10 87915425 missense probably benign 0.01
R6893:Igf1 UTSW 10 87864860 missense probably damaging 1.00
R6954:Igf1 UTSW 10 87864860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGCTCTTCTAGGACAGAGC -3'
(R):5'- ACTCAGTTATTCGACCAATCCC -3'

Sequencing Primer
(F):5'- CTCTTCTAGGACAGAGCGTTTGAATG -3'
(R):5'- CCAATCCCTGTGGTTATAAATCCAGG -3'
Posted On 2014-11-12