Mutagenetix > Incidental Mutation

Incidental Mutation 'R2428:Igf1'

250313

Institutional Source

Beutler Lab

Gene Symbol

Igf1

Ensembl Gene

ENSMUSG00000020053

Gene Name

insulin-like growth factor 1

Synonyms

Igf-1, C730016P09Rik, Igf-I

MMRRC Submission

040390-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2428 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87694127-87772904 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87700683 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 36 (T36A)

Ref Sequence

ENSEMBL: ENSMUSP00000122188 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062862] [ENSMUST00000095360] [ENSMUST00000105300] [ENSMUST00000121161] [ENSMUST00000121952] [ENSMUST00000122100] [ENSMUST00000122386] [ENSMUST00000126490]

AlphaFold

P05017

Predicted Effect

probably damaging
Transcript: ENSMUST00000062862
AA Change: T36A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000056668
Gene: ENSMUSG00000020053
AA Change: T36A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
IlGF	35	93	9.22e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000095360
AA Change: T52A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000093005
Gene: ENSMUSG00000020053
AA Change: T52A

Domain	Start	End	E-Value	Type
IlGF	51	109	9.22e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105300
AA Change: T52A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000100937
Gene: ENSMUSG00000020053
AA Change: T52A

Domain	Start	End	E-Value	Type
IlGF	51	109	9.22e-24	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121161
AA Change: T36A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000114120
Gene: ENSMUSG00000020053
AA Change: T36A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
IlGF	35	93	9.22e-24	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121952
AA Change: T36A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000113177
Gene: ENSMUSG00000020053
AA Change: T36A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
IlGF	35	93	9.22e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000122100
AA Change: T36A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112878
Gene: ENSMUSG00000020053
AA Change: T36A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
IlGF	35	93	9.22e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000122386
AA Change: T52A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113905
Gene: ENSMUSG00000020053
AA Change: T52A

Domain	Start	End	E-Value	Type
IlGF	51	109	9.22e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000126490
AA Change: T36A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122188
Gene: ENSMUSG00000020053
AA Change: T36A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
IlGF	35	93	9.22e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146581

Meta Mutation Damage Score

0.5902

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (31/31)

MGI Phenotype

FUNCTION: This gene encodes a member of the insulin-like growth factor (IGF) family of proteins that promote growth and development during fetal and postnatal life. This gene is predominantly expressed in the liver and the encoded protein undergoes proteolytic processing to generate a disulfide-linked mature polypeptide. Transgenic disruption of this gene in mice results in reduced postnatal survival and severe growth retardation. Mice lacking the encoded protein exhibit generalized organ hypoplasia including underdevelopment of the central nervous system and developmental defects in bone, muscle and reproductive systems. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants are severely growth retarded and die perinatally with many immature organ systems. Heterozygotes and partial knockouts show genetic background effects and can display growth retardation and abnormalities in muscle, lungs, and CNS. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad9	G	A	3: 36,145,072 (GRCm39)	A624T	probably benign	Het
Astn1	C	T	1: 158,439,916 (GRCm39)	A828V	possibly damaging	Het
Bag6	A	C	17: 35,366,151 (GRCm39)	D1117A	probably damaging	Het
Col12a1	A	T	9: 79,509,533 (GRCm39)	C3042S	probably benign	Het
Ctc1	G	A	11: 68,918,527 (GRCm39)	V265I	possibly damaging	Het
Cubn	T	C	2: 13,480,961 (GRCm39)	Y298C	probably damaging	Het
Dmtn	G	A	14: 70,850,843 (GRCm39)	R183W	probably damaging	Het
F2rl2	T	A	13: 95,833,585 (GRCm39)	I5N	possibly damaging	Het
Gpr137c	A	G	14: 45,516,420 (GRCm39)	Y336C	probably damaging	Het
Gstm6	T	A	3: 107,850,922 (GRCm39)	I10F	possibly damaging	Het
Hivep3	T	A	4: 119,955,705 (GRCm39)	C1340*	probably null	Het
Lrch1	T	A	14: 75,044,985 (GRCm39)		probably benign	Het
Mrpl40	A	T	16: 18,691,125 (GRCm39)	I195N	probably damaging	Het
Myg1	G	C	15: 102,246,171 (GRCm39)	G349R	probably damaging	Het
Ndufc1	A	C	3: 51,315,564 (GRCm39)		probably null	Het
Nfasc	T	C	1: 132,523,392 (GRCm39)	N973S	possibly damaging	Het
Or4f62	G	A	2: 111,986,787 (GRCm39)	V164I	probably benign	Het
Or51a43	G	A	7: 103,717,675 (GRCm39)	R188*	probably null	Het
Or6c212	T	C	10: 129,558,652 (GRCm39)	I254V	probably benign	Het
Or9g19	A	T	2: 85,600,322 (GRCm39)	Y59F	probably damaging	Het
Pkdrej	C	A	15: 85,701,773 (GRCm39)	E1388*	probably null	Het
Prrc2b	T	A	2: 32,106,067 (GRCm39)	D1482E	probably benign	Het
Relch	C	T	1: 105,673,851 (GRCm39)	S1080L	possibly damaging	Het
Sppl2a	A	T	2: 126,754,615 (GRCm39)	S403R	possibly damaging	Het
Tespa1	A	G	10: 130,197,944 (GRCm39)	D322G	probably damaging	Het
Tmcc2	C	T	1: 132,288,569 (GRCm39)	V373M	probably damaging	Het
Ttn	T	C	2: 76,644,517 (GRCm39)	N13079S	possibly damaging	Het
Wdr53	A	G	16: 32,071,008 (GRCm39)	I118V	probably benign	Het
Zdbf2	T	C	1: 63,344,774 (GRCm39)	M1051T	probably benign	Het
Zfp784	G	C	7: 5,041,357 (GRCm39)		probably benign	Het

Other mutations in Igf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02485:Igf1	APN	10	87,700,608 (GRCm39)	missense	probably benign
IGL03171:Igf1	APN	10	87,700,683 (GRCm39)	missense	probably damaging	1.00
R1850:Igf1	UTSW	10	87,697,236 (GRCm39)	missense	possibly damaging	0.47
R1962:Igf1	UTSW	10	87,700,726 (GRCm39)	missense	probably damaging	1.00
R3852:Igf1	UTSW	10	87,751,181 (GRCm39)	nonsense	probably null
R4757:Igf1	UTSW	10	87,751,287 (GRCm39)	missense	probably benign	0.01
R6893:Igf1	UTSW	10	87,700,722 (GRCm39)	missense	probably damaging	1.00
R6954:Igf1	UTSW	10	87,700,722 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACTGCTCTTCTAGGACAGAGC -3'
(R):5'- ACTCAGTTATTCGACCAATCCC -3'

Sequencing Primer
(F):5'- CTCTTCTAGGACAGAGCGTTTGAATG -3'
(R):5'- CCAATCCCTGTGGTTATAAATCCAGG -3'

Posted On

2014-11-12