Incidental Mutation 'R2428:F2rl2'
ID 250317
Institutional Source Beutler Lab
Gene Symbol F2rl2
Ensembl Gene ENSMUSG00000021675
Gene Name coagulation factor II (thrombin) receptor-like 2
Synonyms PAR3
MMRRC Submission 040390-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2428 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 95696853-95702739 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 95697077 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 5 (I5N)
Ref Sequence ENSEMBL: ENSMUSP00000022182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022182] [ENSMUST00000068603]
AlphaFold O08675
PDB Structure Crystal structure of murine thrombin in complex with the extracellular fragment of murine PAR3 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022182
AA Change: I5N

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022182
Gene: ENSMUSG00000021675
AA Change: I5N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:7tm_1 110 295 1.7e-32 PFAM
Pfam:7tm_1 297 357 1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068603
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Meta Mutation Damage Score 0.1366 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protease-activated receptor (PAR) family which is a subfamily of the seven transmembrane G protein-coupled cell surface receptor family. The encoded protein acts as a cofactor in the thrombin-mediated cleavage and activation of the protease-activated receptor family member PAR4. The encoded protein plays an essential role in hemostasis and thrombosis. Alternate splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in prolonged bleeding times, delayed and reduced thrombin responses in platelets, and protection against thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,746,126 S1080L possibly damaging Het
Acad9 G A 3: 36,090,923 A624T probably benign Het
Astn1 C T 1: 158,612,346 A828V possibly damaging Het
Bag6 A C 17: 35,147,175 D1117A probably damaging Het
Col12a1 A T 9: 79,602,251 C3042S probably benign Het
Ctc1 G A 11: 69,027,701 V265I possibly damaging Het
Cubn T C 2: 13,476,150 Y298C probably damaging Het
Dmtn G A 14: 70,613,403 R183W probably damaging Het
Gpr137c A G 14: 45,278,963 Y336C probably damaging Het
Gstm6 T A 3: 107,943,606 I10F possibly damaging Het
Hivep3 T A 4: 120,098,508 C1340* probably null Het
Igf1 A G 10: 87,864,821 T36A probably damaging Het
Lrch1 T A 14: 74,807,545 probably benign Het
Mrpl40 A T 16: 18,872,375 I195N probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ndufc1 A C 3: 51,408,143 probably null Het
Nfasc T C 1: 132,595,654 N973S possibly damaging Het
Olfr1013 A T 2: 85,769,978 Y59F probably damaging Het
Olfr1318 G A 2: 112,156,442 V164I probably benign Het
Olfr644 G A 7: 104,068,468 R188* probably null Het
Olfr805 T C 10: 129,722,783 I254V probably benign Het
Pkdrej C A 15: 85,817,572 E1388* probably null Het
Prrc2b T A 2: 32,216,055 D1482E probably benign Het
Sppl2a A T 2: 126,912,695 S403R possibly damaging Het
Tespa1 A G 10: 130,362,075 D322G probably damaging Het
Tmcc2 C T 1: 132,360,831 V373M probably damaging Het
Ttn T C 2: 76,814,173 N13079S possibly damaging Het
Wdr53 A G 16: 32,252,190 I118V probably benign Het
Zdbf2 T C 1: 63,305,615 M1051T probably benign Het
Zfp784 G C 7: 5,038,358 probably benign Het
Other mutations in F2rl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:F2rl2 APN 13 95701328 missense probably benign 0.00
R0014:F2rl2 UTSW 13 95700909 missense probably damaging 0.99
R0014:F2rl2 UTSW 13 95700909 missense probably damaging 0.99
R0969:F2rl2 UTSW 13 95700953 missense probably damaging 1.00
R1183:F2rl2 UTSW 13 95701113 missense probably damaging 0.96
R1482:F2rl2 UTSW 13 95701539 missense probably benign 0.02
R1753:F2rl2 UTSW 13 95701461 missense probably benign 0.16
R3151:F2rl2 UTSW 13 95701130 missense probably benign 0.00
R4678:F2rl2 UTSW 13 95700632 missense probably benign 0.10
R5153:F2rl2 UTSW 13 95697112 missense probably benign 0.00
R5229:F2rl2 UTSW 13 95700687 missense possibly damaging 0.93
R5635:F2rl2 UTSW 13 95700782 missense possibly damaging 0.88
R6041:F2rl2 UTSW 13 95701109 missense probably benign 0.01
R6146:F2rl2 UTSW 13 95700641 missense probably benign 0.08
R6974:F2rl2 UTSW 13 95700530 missense probably damaging 0.97
R6993:F2rl2 UTSW 13 95701134 missense probably damaging 1.00
R7833:F2rl2 UTSW 13 95700918 missense probably damaging 0.96
R7869:F2rl2 UTSW 13 95701011 missense probably damaging 0.99
R8187:F2rl2 UTSW 13 95701403 missense probably benign 0.00
R8694:F2rl2 UTSW 13 95700831 missense probably benign 0.00
R9445:F2rl2 UTSW 13 95701114 missense probably benign 0.28
R9694:F2rl2 UTSW 13 95701542 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TCAGCCTGAGTCATGCACAC -3'
(R):5'- AACCAGATCAAATTGTGTCTTTGGG -3'

Sequencing Primer
(F):5'- TGAGTCATGCACACAGACAG -3'
(R):5'- GGTTCACAGTTTCTAGGAGTTAAC -3'
Posted On 2014-11-12