Incidental Mutation 'R2428:Gpr137c'
ID250318
Institutional Source Beutler Lab
Gene Symbol Gpr137c
Ensembl Gene ENSMUSG00000049092
Gene NameG protein-coupled receptor 137C
SynonymsLOC380893, 6330416L11Rik, TM7SF1L2
MMRRC Submission 040390-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2428 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location45219717-45282725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45278963 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 336 (Y336C)
Ref Sequence ENSEMBL: ENSMUSP00000120015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022378] [ENSMUST00000146150] [ENSMUST00000151749]
Predicted Effect probably benign
Transcript: ENSMUST00000022378
SMART Domains Protein: ENSMUSP00000022378
Gene: ENSMUSG00000021831

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:ERO1 60 453 3.7e-128 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146150
AA Change: Y336C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120015
Gene: ENSMUSG00000049092
AA Change: Y336C

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 23 39 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Blast:G_alpha 121 286 9e-17 BLAST
transmembrane domain 294 316 N/A INTRINSIC
low complexity region 376 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227166
Meta Mutation Damage Score 0.2667 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,746,126 S1080L possibly damaging Het
Acad9 G A 3: 36,090,923 A624T probably benign Het
Astn1 C T 1: 158,612,346 A828V possibly damaging Het
Bag6 A C 17: 35,147,175 D1117A probably damaging Het
Col12a1 A T 9: 79,602,251 C3042S probably benign Het
Ctc1 G A 11: 69,027,701 V265I possibly damaging Het
Cubn T C 2: 13,476,150 Y298C probably damaging Het
Dmtn G A 14: 70,613,403 R183W probably damaging Het
F2rl2 T A 13: 95,697,077 I5N possibly damaging Het
Gstm6 T A 3: 107,943,606 I10F possibly damaging Het
Hivep3 T A 4: 120,098,508 C1340* probably null Het
Igf1 A G 10: 87,864,821 T36A probably damaging Het
Lrch1 T A 14: 74,807,545 probably benign Het
Mrpl40 A T 16: 18,872,375 I195N probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ndufc1 A C 3: 51,408,143 probably null Het
Nfasc T C 1: 132,595,654 N973S possibly damaging Het
Olfr1013 A T 2: 85,769,978 Y59F probably damaging Het
Olfr1318 G A 2: 112,156,442 V164I probably benign Het
Olfr644 G A 7: 104,068,468 R188* probably null Het
Olfr805 T C 10: 129,722,783 I254V probably benign Het
Pkdrej C A 15: 85,817,572 E1388* probably null Het
Prrc2b T A 2: 32,216,055 D1482E probably benign Het
Sppl2a A T 2: 126,912,695 S403R possibly damaging Het
Tespa1 A G 10: 130,362,075 D322G probably damaging Het
Tmcc2 C T 1: 132,360,831 V373M probably damaging Het
Ttn T C 2: 76,814,173 N13079S possibly damaging Het
Wdr53 A G 16: 32,252,190 I118V probably benign Het
Zdbf2 T C 1: 63,305,615 M1051T probably benign Het
Zfp784 G C 7: 5,038,358 probably benign Het
Other mutations in Gpr137c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Gpr137c APN 14 45278745 missense probably damaging 0.97
IGL02167:Gpr137c APN 14 45279955 missense probably damaging 0.98
IGL02203:Gpr137c APN 14 45277487 missense possibly damaging 0.86
IGL02960:Gpr137c APN 14 45246433 missense possibly damaging 0.92
R0731:Gpr137c UTSW 14 45246349 missense probably damaging 1.00
R1162:Gpr137c UTSW 14 45244158 missense possibly damaging 0.89
R1245:Gpr137c UTSW 14 45279065 utr 3 prime probably benign
R1983:Gpr137c UTSW 14 45279971 missense probably benign 0.01
R2060:Gpr137c UTSW 14 45244159 missense probably damaging 1.00
R3034:Gpr137c UTSW 14 45220276 missense probably damaging 0.99
R3911:Gpr137c UTSW 14 45278935 missense probably benign 0.31
R4037:Gpr137c UTSW 14 45220230 missense probably damaging 0.99
R4038:Gpr137c UTSW 14 45220230 missense probably damaging 0.99
R4213:Gpr137c UTSW 14 45246508 missense probably damaging 0.99
R4986:Gpr137c UTSW 14 45246286 critical splice acceptor site probably null
R5521:Gpr137c UTSW 14 45278694 missense possibly damaging 0.92
R6028:Gpr137c UTSW 14 45277481 missense probably damaging 0.96
R7117:Gpr137c UTSW 14 45279027 missense probably damaging 1.00
R7238:Gpr137c UTSW 14 45278691 missense probably damaging 1.00
R7365:Gpr137c UTSW 14 45279014 missense probably damaging 1.00
X0027:Gpr137c UTSW 14 45278669 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTTCTGTGGGAGCATGTACCAG -3'
(R):5'- TTGATGTATATTGCCAGATCCCTG -3'

Sequencing Primer
(F):5'- ACTATTTTTCCGGGCACAGAG -3'
(R):5'- CAGATCCCTGGTTCGATGG -3'
Posted On2014-11-12