Incidental Mutation 'R2428:Myg1'
ID 250321
Institutional Source Beutler Lab
Gene Symbol Myg1
Ensembl Gene ENSMUSG00000001285
Gene Name melanocyte proliferating gene 1
Synonyms Gamm1
MMRRC Submission 040390-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock # R2428 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 102331709-102338139 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 102337736 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 349 (G349R)
Ref Sequence ENSEMBL: ENSMUSP00000109312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001331] [ENSMUST00000041208] [ENSMUST00000113682] [ENSMUST00000228959] [ENSMUST00000229900] [ENSMUST00000230481] [ENSMUST00000231061]
AlphaFold Q9JK81
Predicted Effect probably damaging
Transcript: ENSMUST00000001331
AA Change: G295R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001331
Gene: ENSMUSG00000001285
AA Change: G295R

DomainStartEndE-ValueType
Pfam:UPF0160 41 161 4.8e-54 PFAM
Pfam:UPF0160 158 312 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041208
SMART Domains Protein: ENSMUSP00000044604
Gene: ENSMUSG00000036678

DomainStartEndE-ValueType
WD40 136 179 3.7e0 SMART
WD40 181 221 4.75e1 SMART
WD40 232 273 1.17e-5 SMART
WD40 278 315 2.66e0 SMART
Blast:WD40 319 357 2e-15 BLAST
low complexity region 534 545 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113682
AA Change: G349R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109312
Gene: ENSMUSG00000001285
AA Change: G349R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UPF0160 45 365 1.5e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170713
Predicted Effect unknown
Transcript: ENSMUST00000171244
AA Change: G303R
SMART Domains Protein: ENSMUSP00000129494
Gene: ENSMUSG00000001285
AA Change: G303R

DomainStartEndE-ValueType
Pfam:UPF0160 41 209 1.7e-76 PFAM
Pfam:UPF0160 204 306 3.3e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171733
Predicted Effect probably benign
Transcript: ENSMUST00000228959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229315
Predicted Effect probably benign
Transcript: ENSMUST00000230239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229589
Predicted Effect probably benign
Transcript: ENSMUST00000229900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230710
Predicted Effect probably benign
Transcript: ENSMUST00000230481
Predicted Effect probably benign
Transcript: ENSMUST00000230406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230812
Predicted Effect probably benign
Transcript: ENSMUST00000231061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231099
Meta Mutation Damage Score 0.9645 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (31/31)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display no gross abnormalities but altered sex-dependent anxiety-like behaviors in different tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,746,126 S1080L possibly damaging Het
Acad9 G A 3: 36,090,923 A624T probably benign Het
Astn1 C T 1: 158,612,346 A828V possibly damaging Het
Bag6 A C 17: 35,147,175 D1117A probably damaging Het
Col12a1 A T 9: 79,602,251 C3042S probably benign Het
Ctc1 G A 11: 69,027,701 V265I possibly damaging Het
Cubn T C 2: 13,476,150 Y298C probably damaging Het
Dmtn G A 14: 70,613,403 R183W probably damaging Het
F2rl2 T A 13: 95,697,077 I5N possibly damaging Het
Gpr137c A G 14: 45,278,963 Y336C probably damaging Het
Gstm6 T A 3: 107,943,606 I10F possibly damaging Het
Hivep3 T A 4: 120,098,508 C1340* probably null Het
Igf1 A G 10: 87,864,821 T36A probably damaging Het
Lrch1 T A 14: 74,807,545 probably benign Het
Mrpl40 A T 16: 18,872,375 I195N probably damaging Het
Ndufc1 A C 3: 51,408,143 probably null Het
Nfasc T C 1: 132,595,654 N973S possibly damaging Het
Olfr1013 A T 2: 85,769,978 Y59F probably damaging Het
Olfr1318 G A 2: 112,156,442 V164I probably benign Het
Olfr644 G A 7: 104,068,468 R188* probably null Het
Olfr805 T C 10: 129,722,783 I254V probably benign Het
Pkdrej C A 15: 85,817,572 E1388* probably null Het
Prrc2b T A 2: 32,216,055 D1482E probably benign Het
Sppl2a A T 2: 126,912,695 S403R possibly damaging Het
Tespa1 A G 10: 130,362,075 D322G probably damaging Het
Tmcc2 C T 1: 132,360,831 V373M probably damaging Het
Ttn T C 2: 76,814,173 N13079S possibly damaging Het
Wdr53 A G 16: 32,252,190 I118V probably benign Het
Zdbf2 T C 1: 63,305,615 M1051T probably benign Het
Zfp784 G C 7: 5,038,358 probably benign Het
Other mutations in Myg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Myg1 APN 15 102334338 missense probably benign 0.00
IGL02188:Myg1 APN 15 102337441 missense probably benign 0.08
IGL02373:Myg1 APN 15 102336833 missense probably damaging 0.99
IGL02885:Myg1 APN 15 102332159 missense probably damaging 1.00
IGL03066:Myg1 APN 15 102334366 unclassified probably benign
R0583:Myg1 UTSW 15 102337790 nonsense probably null
R0631:Myg1 UTSW 15 102331849 missense probably benign 0.00
R0835:Myg1 UTSW 15 102332102 missense probably damaging 1.00
R1016:Myg1 UTSW 15 102334351 missense possibly damaging 0.50
R1466:Myg1 UTSW 15 102337390 missense probably damaging 1.00
R1466:Myg1 UTSW 15 102337390 missense probably damaging 1.00
R1757:Myg1 UTSW 15 102331829 missense probably benign
R2400:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R2429:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R2431:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R2997:Myg1 UTSW 15 102337510 missense probably null 1.00
R3683:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R3826:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R3827:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R3829:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R4923:Myg1 UTSW 15 102331853 missense probably benign
R5363:Myg1 UTSW 15 102337824 missense probably benign 0.00
R5419:Myg1 UTSW 15 102336962 missense probably damaging 0.99
R9389:Myg1 UTSW 15 102336937 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACTCTACCTACCTTGAAGTCTG -3'
(R):5'- TGAGATGGTTGTCAACTGAAAAGC -3'

Sequencing Primer
(F):5'- ACCTTGAAGTCTGTCTCAGCAC -3'
(R):5'- GTTGTCAACTGAAAAGCAAAGCAC -3'
Posted On 2014-11-12