Incidental Mutation 'R2428:Mrpl40'
ID 250322
Institutional Source Beutler Lab
Gene Symbol Mrpl40
Ensembl Gene ENSMUSG00000022706
Gene Name mitochondrial ribosomal protein L40
Synonyms Nlvcf
MMRRC Submission 040390-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock # R2428 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 18872018-18876862 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 18872375 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 195 (I195N)
Ref Sequence ENSEMBL: ENSMUSP00000023391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004222] [ENSMUST00000023391] [ENSMUST00000119273] [ENSMUST00000120532] [ENSMUST00000144609] [ENSMUST00000153397] [ENSMUST00000190050]
AlphaFold Q9Z2Q5
Predicted Effect probably benign
Transcript: ENSMUST00000004222
SMART Domains Protein: ENSMUSP00000004222
Gene: ENSMUSG00000022702

DomainStartEndE-ValueType
WD40 1 44 1.56e-1 SMART
WD40 59 98 9.67e-7 SMART
WD40 120 159 3.58e-10 SMART
WD40 163 202 7.22e-6 SMART
WD40 212 254 9.17e1 SMART
WD40 257 313 1.54e0 SMART
WD40 319 356 2.86e0 SMART
low complexity region 405 412 N/A INTRINSIC
Pfam:HIRA_B 448 470 1.9e-10 PFAM
low complexity region 493 507 N/A INTRINSIC
low complexity region 540 556 N/A INTRINSIC
low complexity region 600 614 N/A INTRINSIC
low complexity region 626 641 N/A INTRINSIC
Pfam:Hira 761 960 2.9e-61 PFAM
low complexity region 979 989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000023391
AA Change: I195N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023391
Gene: ENSMUSG00000022706
AA Change: I195N

DomainStartEndE-ValueType
Pfam:MRP-L28 45 199 1.3e-64 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119273
AA Change: I151N

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113065
Gene: ENSMUSG00000022706
AA Change: I151N

DomainStartEndE-ValueType
Pfam:MRP-L28 1 155 6.4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120532
SMART Domains Protein: ENSMUSP00000112614
Gene: ENSMUSG00000022702

DomainStartEndE-ValueType
WD40 15 54 9.67e-7 SMART
WD40 76 115 3.58e-10 SMART
WD40 119 158 7.22e-6 SMART
WD40 168 210 9.17e1 SMART
WD40 213 269 1.54e0 SMART
WD40 275 312 2.86e0 SMART
low complexity region 361 368 N/A INTRINSIC
Pfam:HIRA_B 404 427 1.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144609
Predicted Effect probably benign
Transcript: ENSMUST00000153397
SMART Domains Protein: ENSMUSP00000117944
Gene: ENSMUSG00000022702

DomainStartEndE-ValueType
Blast:WD40 1 40 1e-18 BLAST
SCOP:d1erja_ 7 33 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190050
SMART Domains Protein: ENSMUSP00000141101
Gene: ENSMUSG00000099908

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232123
Meta Mutation Damage Score 0.8477 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Deletions in this gene may contribute to the etiology of velo-cardio-facial syndrome and DiGeorge syndrome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,746,126 S1080L possibly damaging Het
Acad9 G A 3: 36,090,923 A624T probably benign Het
Astn1 C T 1: 158,612,346 A828V possibly damaging Het
Bag6 A C 17: 35,147,175 D1117A probably damaging Het
Col12a1 A T 9: 79,602,251 C3042S probably benign Het
Ctc1 G A 11: 69,027,701 V265I possibly damaging Het
Cubn T C 2: 13,476,150 Y298C probably damaging Het
Dmtn G A 14: 70,613,403 R183W probably damaging Het
F2rl2 T A 13: 95,697,077 I5N possibly damaging Het
Gpr137c A G 14: 45,278,963 Y336C probably damaging Het
Gstm6 T A 3: 107,943,606 I10F possibly damaging Het
Hivep3 T A 4: 120,098,508 C1340* probably null Het
Igf1 A G 10: 87,864,821 T36A probably damaging Het
Lrch1 T A 14: 74,807,545 probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ndufc1 A C 3: 51,408,143 probably null Het
Nfasc T C 1: 132,595,654 N973S possibly damaging Het
Olfr1013 A T 2: 85,769,978 Y59F probably damaging Het
Olfr1318 G A 2: 112,156,442 V164I probably benign Het
Olfr644 G A 7: 104,068,468 R188* probably null Het
Olfr805 T C 10: 129,722,783 I254V probably benign Het
Pkdrej C A 15: 85,817,572 E1388* probably null Het
Prrc2b T A 2: 32,216,055 D1482E probably benign Het
Sppl2a A T 2: 126,912,695 S403R possibly damaging Het
Tespa1 A G 10: 130,362,075 D322G probably damaging Het
Tmcc2 C T 1: 132,360,831 V373M probably damaging Het
Ttn T C 2: 76,814,173 N13079S possibly damaging Het
Wdr53 A G 16: 32,252,190 I118V probably benign Het
Zdbf2 T C 1: 63,305,615 M1051T probably benign Het
Zfp784 G C 7: 5,038,358 probably benign Het
Other mutations in Mrpl40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01619:Mrpl40 APN 16 18872544 missense probably benign 0.02
IGL01649:Mrpl40 APN 16 18872579 missense probably benign 0.02
R0524:Mrpl40 UTSW 16 18873552 missense possibly damaging 0.93
R1509:Mrpl40 UTSW 16 18875409 critical splice acceptor site probably null
R1876:Mrpl40 UTSW 16 18872474 missense probably benign 0.17
R2251:Mrpl40 UTSW 16 18875375 missense probably benign 0.03
R2252:Mrpl40 UTSW 16 18875375 missense probably benign 0.03
R4512:Mrpl40 UTSW 16 18872558 missense probably benign 0.02
R5877:Mrpl40 UTSW 16 18872385 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAGTCAAACTTAGGTGAATTC -3'
(R):5'- ATCCATGCTAGAAGCCCAGC -3'

Sequencing Primer
(F):5'- AATTTCCGAGTTCGAGGCCAG -3'
(R):5'- CTAGAAGCCCAGCAGGAAGC -3'
Posted On 2014-11-12