Incidental Mutation 'R2428:Bag6'
ID 250324
Institutional Source Beutler Lab
Gene Symbol Bag6
Ensembl Gene ENSMUSG00000024392
Gene Name BCL2-associated athanogene 6
Synonyms Scythe, G3, D17H6S52E, Bat3, 2410045D21Rik
MMRRC Submission 040390-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2428 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 35135178-35147322 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 35147175 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 1117 (D1117A)
Ref Sequence ENSEMBL: ENSMUSP00000129324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025250] [ENSMUST00000025253] [ENSMUST00000166426] [ENSMUST00000172571] [ENSMUST00000173535] [ENSMUST00000173550] [ENSMUST00000174281] [ENSMUST00000174805]
AlphaFold Q9Z1R2
Predicted Effect unknown
Transcript: ENSMUST00000025250
AA Change: D1135A
SMART Domains Protein: ENSMUSP00000025250
Gene: ENSMUSG00000024392
AA Change: D1135A

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 220 239 N/A INTRINSIC
low complexity region 246 264 N/A INTRINSIC
Pfam:DUF3538 277 393 1.7e-44 PFAM
low complexity region 427 438 N/A INTRINSIC
low complexity region 557 625 N/A INTRINSIC
low complexity region 632 648 N/A INTRINSIC
low complexity region 673 721 N/A INTRINSIC
low complexity region 725 747 N/A INTRINSIC
low complexity region 765 780 N/A INTRINSIC
low complexity region 798 808 N/A INTRINSIC
low complexity region 1029 1042 N/A INTRINSIC
low complexity region 1088 1098 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025253
SMART Domains Protein: ENSMUSP00000025253
Gene: ENSMUSG00000024393

DomainStartEndE-ValueType
Pfam:BAT2_N 1 189 1.2e-70 PFAM
low complexity region 243 276 N/A INTRINSIC
low complexity region 343 357 N/A INTRINSIC
low complexity region 396 413 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
coiled coil region 455 494 N/A INTRINSIC
low complexity region 504 523 N/A INTRINSIC
low complexity region 527 566 N/A INTRINSIC
low complexity region 593 618 N/A INTRINSIC
low complexity region 643 684 N/A INTRINSIC
low complexity region 687 709 N/A INTRINSIC
low complexity region 711 717 N/A INTRINSIC
low complexity region 755 768 N/A INTRINSIC
low complexity region 826 833 N/A INTRINSIC
low complexity region 861 871 N/A INTRINSIC
low complexity region 882 894 N/A INTRINSIC
low complexity region 902 924 N/A INTRINSIC
low complexity region 944 966 N/A INTRINSIC
low complexity region 1032 1070 N/A INTRINSIC
low complexity region 1129 1149 N/A INTRINSIC
low complexity region 1162 1179 N/A INTRINSIC
low complexity region 1190 1211 N/A INTRINSIC
low complexity region 1234 1242 N/A INTRINSIC
low complexity region 1285 1300 N/A INTRINSIC
low complexity region 1346 1360 N/A INTRINSIC
low complexity region 1394 1424 N/A INTRINSIC
low complexity region 1430 1456 N/A INTRINSIC
low complexity region 1488 1511 N/A INTRINSIC
low complexity region 1553 1565 N/A INTRINSIC
low complexity region 1693 1713 N/A INTRINSIC
internal_repeat_1 1810 1860 5.56e-5 PROSPERO
low complexity region 1879 1895 N/A INTRINSIC
internal_repeat_1 1924 1983 5.56e-5 PROSPERO
low complexity region 1995 2017 N/A INTRINSIC
low complexity region 2019 2041 N/A INTRINSIC
low complexity region 2070 2086 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166426
AA Change: D1117A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129324
Gene: ENSMUSG00000024392
AA Change: D1117A

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 228 246 N/A INTRINSIC
Pfam:DUF3538 259 375 3.7e-53 PFAM
low complexity region 409 420 N/A INTRINSIC
low complexity region 539 607 N/A INTRINSIC
low complexity region 614 630 N/A INTRINSIC
low complexity region 655 703 N/A INTRINSIC
low complexity region 707 729 N/A INTRINSIC
low complexity region 747 762 N/A INTRINSIC
low complexity region 780 790 N/A INTRINSIC
low complexity region 1011 1024 N/A INTRINSIC
low complexity region 1070 1080 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172571
AA Change: D1063A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134175
Gene: ENSMUSG00000024392
AA Change: D1063A

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 228 252 N/A INTRINSIC
Pfam:DUF3538 254 370 3.5e-53 PFAM
low complexity region 404 415 N/A INTRINSIC
low complexity region 534 602 N/A INTRINSIC
low complexity region 609 625 N/A INTRINSIC
low complexity region 650 698 N/A INTRINSIC
low complexity region 702 724 N/A INTRINSIC
low complexity region 742 757 N/A INTRINSIC
low complexity region 775 785 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172899
Predicted Effect unknown
Transcript: ENSMUST00000172993
AA Change: D100A
Predicted Effect probably benign
Transcript: ENSMUST00000173535
SMART Domains Protein: ENSMUSP00000133822
Gene: ENSMUSG00000024392

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 20 29 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
UBQ 58 128 5.62e-22 SMART
low complexity region 137 153 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
low complexity region 261 280 N/A INTRINSIC
low complexity region 287 305 N/A INTRINSIC
Pfam:DUF3538 318 434 1.3e-53 PFAM
low complexity region 468 479 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000173550
AA Change: D1103A
SMART Domains Protein: ENSMUSP00000134628
Gene: ENSMUSG00000024392
AA Change: D1103A

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 228 246 N/A INTRINSIC
Pfam:DUF3538 259 375 3.7e-53 PFAM
low complexity region 409 420 N/A INTRINSIC
low complexity region 496 511 N/A INTRINSIC
low complexity region 574 642 N/A INTRINSIC
low complexity region 649 665 N/A INTRINSIC
low complexity region 690 738 N/A INTRINSIC
low complexity region 742 764 N/A INTRINSIC
low complexity region 782 797 N/A INTRINSIC
low complexity region 815 825 N/A INTRINSIC
low complexity region 1046 1059 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173558
Predicted Effect probably benign
Transcript: ENSMUST00000174281
SMART Domains Protein: ENSMUSP00000134425
Gene: ENSMUSG00000024392

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 220 239 N/A INTRINSIC
low complexity region 246 264 N/A INTRINSIC
Pfam:DUF3538 277 393 3.6e-53 PFAM
low complexity region 427 438 N/A INTRINSIC
low complexity region 514 529 N/A INTRINSIC
low complexity region 592 660 N/A INTRINSIC
low complexity region 667 683 N/A INTRINSIC
low complexity region 708 756 N/A INTRINSIC
low complexity region 760 782 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 1064 1077 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174613
Predicted Effect probably benign
Transcript: ENSMUST00000174805
SMART Domains Protein: ENSMUSP00000133550
Gene: ENSMUSG00000024393

DomainStartEndE-ValueType
Pfam:BAT2_N 1 137 6.6e-53 PFAM
low complexity region 188 221 N/A INTRINSIC
low complexity region 288 302 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
coiled coil region 400 439 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 472 511 N/A INTRINSIC
low complexity region 538 563 N/A INTRINSIC
low complexity region 588 629 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 656 662 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
low complexity region 771 778 N/A INTRINSIC
low complexity region 806 816 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 847 869 N/A INTRINSIC
low complexity region 889 911 N/A INTRINSIC
low complexity region 977 1015 N/A INTRINSIC
low complexity region 1074 1094 N/A INTRINSIC
low complexity region 1107 1124 N/A INTRINSIC
low complexity region 1135 1156 N/A INTRINSIC
low complexity region 1179 1187 N/A INTRINSIC
low complexity region 1230 1245 N/A INTRINSIC
low complexity region 1291 1305 N/A INTRINSIC
low complexity region 1339 1369 N/A INTRINSIC
low complexity region 1375 1401 N/A INTRINSIC
low complexity region 1433 1456 N/A INTRINSIC
low complexity region 1498 1510 N/A INTRINSIC
low complexity region 1638 1658 N/A INTRINSIC
internal_repeat_1 1755 1804 3.99e-5 PROSPERO
low complexity region 1823 1839 N/A INTRINSIC
internal_repeat_1 1868 1927 3.99e-5 PROSPERO
low complexity region 1939 1961 N/A INTRINSIC
low complexity region 1963 1985 N/A INTRINSIC
low complexity region 2014 2030 N/A INTRINSIC
Meta Mutation Damage Score 0.1262 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was first characterized as part of a cluster of genes located within the human major histocompatibility complex class III region. This gene encodes a nuclear protein that is cleaved by caspase 3 and is implicated in the control of apoptosis. In addition, the protein forms a complex with E1A binding protein p300 and is required for the acetylation of p53 in response to DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in either embryonic lethality following abnormal brain development or neonatal death associated with severe developmental defects in the lung and kidney. These developmental defects are associated with widespread aberrant apoptosis and proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,746,126 S1080L possibly damaging Het
Acad9 G A 3: 36,090,923 A624T probably benign Het
Astn1 C T 1: 158,612,346 A828V possibly damaging Het
Col12a1 A T 9: 79,602,251 C3042S probably benign Het
Ctc1 G A 11: 69,027,701 V265I possibly damaging Het
Cubn T C 2: 13,476,150 Y298C probably damaging Het
Dmtn G A 14: 70,613,403 R183W probably damaging Het
F2rl2 T A 13: 95,697,077 I5N possibly damaging Het
Gpr137c A G 14: 45,278,963 Y336C probably damaging Het
Gstm6 T A 3: 107,943,606 I10F possibly damaging Het
Hivep3 T A 4: 120,098,508 C1340* probably null Het
Igf1 A G 10: 87,864,821 T36A probably damaging Het
Lrch1 T A 14: 74,807,545 probably benign Het
Mrpl40 A T 16: 18,872,375 I195N probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ndufc1 A C 3: 51,408,143 probably null Het
Nfasc T C 1: 132,595,654 N973S possibly damaging Het
Olfr1013 A T 2: 85,769,978 Y59F probably damaging Het
Olfr1318 G A 2: 112,156,442 V164I probably benign Het
Olfr644 G A 7: 104,068,468 R188* probably null Het
Olfr805 T C 10: 129,722,783 I254V probably benign Het
Pkdrej C A 15: 85,817,572 E1388* probably null Het
Prrc2b T A 2: 32,216,055 D1482E probably benign Het
Sppl2a A T 2: 126,912,695 S403R possibly damaging Het
Tespa1 A G 10: 130,362,075 D322G probably damaging Het
Tmcc2 C T 1: 132,360,831 V373M probably damaging Het
Ttn T C 2: 76,814,173 N13079S possibly damaging Het
Wdr53 A G 16: 32,252,190 I118V probably benign Het
Zdbf2 T C 1: 63,305,615 M1051T probably benign Het
Zfp784 G C 7: 5,038,358 probably benign Het
Other mutations in Bag6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Bag6 APN 17 35144651 missense probably damaging 1.00
IGL00489:Bag6 APN 17 35144651 missense probably damaging 1.00
IGL01613:Bag6 APN 17 35143016 unclassified probably benign
IGL01735:Bag6 APN 17 35145761 unclassified probably benign
IGL02146:Bag6 APN 17 35136215 missense probably damaging 1.00
IGL03092:Bag6 APN 17 35145627 missense probably damaging 1.00
IGL03377:Bag6 APN 17 35144982 missense probably damaging 1.00
Hobbit UTSW 17 35145922 critical splice donor site probably null
Hunter UTSW 17 35145238 splice site probably null
R0196:Bag6 UTSW 17 35144263 missense probably damaging 1.00
R0449:Bag6 UTSW 17 35141466 missense probably damaging 1.00
R1228:Bag6 UTSW 17 35145333 missense probably damaging 0.99
R1450:Bag6 UTSW 17 35141958 missense probably benign 0.01
R1686:Bag6 UTSW 17 35144952 missense possibly damaging 0.84
R1869:Bag6 UTSW 17 35142826 missense probably benign 0.05
R2034:Bag6 UTSW 17 35144692 missense probably damaging 0.99
R2205:Bag6 UTSW 17 35144607 missense probably damaging 1.00
R2987:Bag6 UTSW 17 35145685 nonsense probably null
R4691:Bag6 UTSW 17 35139248 missense probably damaging 1.00
R4705:Bag6 UTSW 17 35142343 missense probably damaging 1.00
R4905:Bag6 UTSW 17 35145186 missense probably damaging 1.00
R5001:Bag6 UTSW 17 35145176 missense probably damaging 1.00
R5168:Bag6 UTSW 17 35144695 missense probably damaging 1.00
R5808:Bag6 UTSW 17 35146322 missense probably damaging 1.00
R6118:Bag6 UTSW 17 35143624 missense probably damaging 0.99
R6212:Bag6 UTSW 17 35140302 missense probably benign 0.17
R6279:Bag6 UTSW 17 35138601 missense probably damaging 1.00
R6300:Bag6 UTSW 17 35138601 missense probably damaging 1.00
R6564:Bag6 UTSW 17 35140371 missense probably damaging 0.98
R6783:Bag6 UTSW 17 35144235 missense possibly damaging 0.94
R6927:Bag6 UTSW 17 35145922 critical splice donor site probably null
R7226:Bag6 UTSW 17 35142945 missense unknown
R7490:Bag6 UTSW 17 35140842 missense unknown
R7499:Bag6 UTSW 17 35144392 missense probably benign 0.29
R7688:Bag6 UTSW 17 35146892 missense probably damaging 0.99
R8016:Bag6 UTSW 17 35138757 missense unknown
R8066:Bag6 UTSW 17 35142307 missense unknown
R8189:Bag6 UTSW 17 35145238 splice site probably null
R8424:Bag6 UTSW 17 35146854 missense probably damaging 1.00
R8542:Bag6 UTSW 17 35144358 missense probably damaging 1.00
R8838:Bag6 UTSW 17 35144391 missense probably damaging 1.00
R8850:Bag6 UTSW 17 35142065 missense unknown
R9022:Bag6 UTSW 17 35144665 missense probably damaging 1.00
R9028:Bag6 UTSW 17 35144154 missense probably benign 0.01
R9128:Bag6 UTSW 17 35144712 missense probably damaging 0.97
R9135:Bag6 UTSW 17 35143461 missense unknown
R9186:Bag6 UTSW 17 35144691 missense probably damaging 1.00
X0025:Bag6 UTSW 17 35146077 nonsense probably null
Z1176:Bag6 UTSW 17 35139310 critical splice donor site probably null
Z1177:Bag6 UTSW 17 35142924 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCATTTGGGAAGGCTTAGC -3'
(R):5'- ACTGATGACACCCCATAAGGAG -3'

Sequencing Primer
(F):5'- GAAGGCTTAGCAATCTCATATTGGGC -3'
(R):5'- CACCCCATAAGGAGAATATGATGTG -3'
Posted On 2014-11-12