Incidental Mutation 'R2429:Trmt1l'
ID 250326
Institutional Source Beutler Lab
Gene Symbol Trmt1l
Ensembl Gene ENSMUSG00000053286
Gene Name tRNA methyltransferase 1 like
Synonyms Trm1-like, 1190005F20Rik
MMRRC Submission 040391-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2429 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 151428542-151458161 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 151433830 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 88 (L88Q)
Ref Sequence ENSEMBL: ENSMUSP00000068309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065625] [ENSMUST00000189655]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000065625
AA Change: L88Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: L88Q

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 25 70 N/A INTRINSIC
ZnF_C2H2 116 142 7.49e0 SMART
ZnF_C2H2 181 203 2.49e-1 SMART
Pfam:TRM 220 563 6.9e-60 PFAM
Pfam:TRM 595 684 6.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188843
Predicted Effect probably benign
Transcript: ENSMUST00000189655
SMART Domains Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286

DomainStartEndE-ValueType
ZnF_C2H2 28 50 1.1e-3 SMART
Meta Mutation Damage Score 0.7001 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik A T 2: 170,579,825 M45K unknown Het
Abcd3 A G 3: 121,792,863 F63L probably damaging Het
Acsm3 A T 7: 119,768,000 M19L probably benign Het
Actn4 T C 7: 28,898,071 K41E probably benign Het
Atp8b3 T A 10: 80,526,894 I677L probably benign Het
Auh C T 13: 52,919,016 G110R probably damaging Het
Batf2 A G 19: 6,171,508 Y116C probably damaging Het
Cntn6 T C 6: 104,650,565 Y120H possibly damaging Het
Gnpat T C 8: 124,877,019 F212S probably damaging Het
Gpd1 A G 15: 99,720,607 M181V probably benign Het
Itgb3 A T 11: 104,637,088 K216N probably damaging Het
Kif21a G A 15: 90,998,005 T32M probably damaging Het
Macf1 A G 4: 123,432,584 V3477A probably damaging Het
Mettl13 A T 1: 162,546,325 L119* probably null Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh8 A G 11: 67,303,897 N1645D probably benign Het
Myo6 T C 9: 80,303,301 probably null Het
Npffr2 A T 5: 89,583,147 Y312F probably damaging Het
Pla2r1 C A 2: 60,514,968 C348F probably damaging Het
Plcb1 A G 2: 135,337,442 N590S probably damaging Het
Prpsap1 G A 11: 116,472,235 T314M probably damaging Het
Prss35 T C 9: 86,755,345 V56A probably benign Het
Setx T C 2: 29,179,898 S2572P probably benign Het
Sf3b1 T C 1: 55,016,801 D93G possibly damaging Het
Slc26a7 C A 4: 14,506,399 probably benign Het
Slc39a12 T G 2: 14,405,086 S298A probably benign Het
Sorl1 G T 9: 42,037,070 D806E probably damaging Het
Syt1 T C 10: 108,690,920 K43E possibly damaging Het
Zfp334 G A 2: 165,380,512 T537I probably damaging Het
Zfp574 T A 7: 25,080,057 L168* probably null Het
Other mutations in Trmt1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Trmt1l APN 1 151442712 critical splice donor site probably null
IGL02175:Trmt1l APN 1 151448484 missense probably benign 0.00
IGL02348:Trmt1l APN 1 151450006 missense probably damaging 1.00
IGL02397:Trmt1l APN 1 151439531 missense probably damaging 1.00
IGL02582:Trmt1l APN 1 151433785 splice site probably benign
IGL03150:Trmt1l APN 1 151453892 missense probably benign 0.00
IGL03220:Trmt1l APN 1 151440941 splice site probably benign
Canyonlands UTSW 1 151454048 nonsense probably null
splendiforous UTSW 1 151453148 missense probably damaging 1.00
IGL03014:Trmt1l UTSW 1 151457930 missense probably damaging 0.99
R0067:Trmt1l UTSW 1 151448380 missense probably benign 0.16
R0067:Trmt1l UTSW 1 151448380 missense probably benign 0.16
R0240:Trmt1l UTSW 1 151457454 unclassified probably benign
R0267:Trmt1l UTSW 1 151457675 unclassified probably benign
R2084:Trmt1l UTSW 1 151440854 missense probably damaging 1.00
R2206:Trmt1l UTSW 1 151435843 critical splice donor site probably null
R2338:Trmt1l UTSW 1 151428959 intron probably benign
R2408:Trmt1l UTSW 1 151439516 missense possibly damaging 0.48
R2520:Trmt1l UTSW 1 151453945 missense probably benign 0.14
R3972:Trmt1l UTSW 1 151433883 missense possibly damaging 0.91
R4092:Trmt1l UTSW 1 151455033 missense probably benign 0.18
R4361:Trmt1l UTSW 1 151435875 intron probably benign
R4411:Trmt1l UTSW 1 151452154 missense probably benign 0.02
R4419:Trmt1l UTSW 1 151440808 missense probably damaging 0.98
R4518:Trmt1l UTSW 1 151448343 nonsense probably null
R4614:Trmt1l UTSW 1 151454048 nonsense probably null
R4617:Trmt1l UTSW 1 151454048 nonsense probably null
R4618:Trmt1l UTSW 1 151454048 nonsense probably null
R4647:Trmt1l UTSW 1 151457881 missense possibly damaging 0.86
R4653:Trmt1l UTSW 1 151439569 missense probably benign 0.00
R4734:Trmt1l UTSW 1 151442637 missense probably benign 0.32
R4873:Trmt1l UTSW 1 151455004 missense probably benign 0.04
R4875:Trmt1l UTSW 1 151455004 missense probably benign 0.04
R5026:Trmt1l UTSW 1 151440876 missense probably damaging 1.00
R5528:Trmt1l UTSW 1 151454995 missense probably benign
R5587:Trmt1l UTSW 1 151435704 intron probably benign
R5872:Trmt1l UTSW 1 151440843 missense probably damaging 1.00
R6060:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
R6169:Trmt1l UTSW 1 151428953 intron probably benign
R6333:Trmt1l UTSW 1 151453934 missense probably benign 0.15
R6906:Trmt1l UTSW 1 151452175 missense probably benign 0.03
R7269:Trmt1l UTSW 1 151457788 missense possibly damaging 0.81
R7574:Trmt1l UTSW 1 151440840 missense possibly damaging 0.95
R7740:Trmt1l UTSW 1 151440888 missense possibly damaging 0.47
R7760:Trmt1l UTSW 1 151442674 missense possibly damaging 0.93
R7984:Trmt1l UTSW 1 151435738 missense probably benign 0.02
R8257:Trmt1l UTSW 1 151428878 start codon destroyed probably null
R8286:Trmt1l UTSW 1 151457792 missense probably damaging 1.00
R8439:Trmt1l UTSW 1 151449976 missense probably benign 0.10
R8451:Trmt1l UTSW 1 151448288 missense unknown
R8514:Trmt1l UTSW 1 151453991 missense probably damaging 0.98
R9287:Trmt1l UTSW 1 151453148 missense probably damaging 1.00
R9423:Trmt1l UTSW 1 151450066 missense possibly damaging 0.90
R9622:Trmt1l UTSW 1 151428959 nonsense probably null
X0039:Trmt1l UTSW 1 151454990 missense possibly damaging 0.88
Z1176:Trmt1l UTSW 1 151453113 missense possibly damaging 0.72
Z1187:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
Z1189:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
Z1190:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
Z1192:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TTGAAAGCTGAAAGGTGCAC -3'
(R):5'- TACATGTCTGCCTGTGCCTG -3'

Sequencing Primer
(F):5'- TTCTAAACTGAACTGTAGCAGTCCC -3'
(R):5'- CCTGGGTGTGCCTGAATG -3'
Posted On 2014-11-12