Incidental Mutation 'R2429:Mettl13'
ID250327
Institutional Source Beutler Lab
Gene Symbol Mettl13
Ensembl Gene ENSMUSG00000026694
Gene Namemethyltransferase like 13
Synonyms5630401D24Rik
MMRRC Submission 040391-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R2429 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location162532127-162548551 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 162546325 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 119 (L119*)
Ref Sequence ENSEMBL: ENSMUSP00000124267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028017] [ENSMUST00000159316] [ENSMUST00000159817] [ENSMUST00000176220]
Predicted Effect probably null
Transcript: ENSMUST00000028017
AA Change: L119*
SMART Domains Protein: ENSMUSP00000028017
Gene: ENSMUSG00000026694
AA Change: L119*

DomainStartEndE-ValueType
Pfam:TPMT 13 172 1e-7 PFAM
Pfam:Ubie_methyltran 38 190 6.6e-7 PFAM
Pfam:Methyltransf_31 46 198 5.3e-13 PFAM
Pfam:Methyltransf_18 48 161 1.1e-10 PFAM
Pfam:Methyltransf_25 52 154 3.7e-9 PFAM
Pfam:Methyltransf_11 53 158 4.1e-16 PFAM
low complexity region 436 452 N/A INTRINSIC
Pfam:Spermine_synth 472 630 7.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159255
Predicted Effect probably null
Transcript: ENSMUST00000159316
AA Change: L68*
SMART Domains Protein: ENSMUSP00000135822
Gene: ENSMUSG00000026694
AA Change: L68*

DomainStartEndE-ValueType
Pfam:Methyltransf_25 1 101 2.7e-10 PFAM
Pfam:Methyltransf_18 1 102 8e-11 PFAM
Pfam:Methyltransf_31 1 149 1.9e-12 PFAM
Pfam:Methyltransf_11 2 100 1.5e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159817
AA Change: L119*
SMART Domains Protein: ENSMUSP00000124267
Gene: ENSMUSG00000026694
AA Change: L119*

DomainStartEndE-ValueType
Pfam:TPMT 13 144 4.6e-8 PFAM
Pfam:Methyltransf_31 46 195 3.5e-12 PFAM
Pfam:Methyltransf_18 48 160 5e-11 PFAM
Pfam:Methyltransf_25 52 154 1.1e-9 PFAM
Pfam:Methyltransf_11 53 158 6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161760
Predicted Effect probably benign
Transcript: ENSMUST00000176220
SMART Domains Protein: ENSMUSP00000135879
Gene: ENSMUSG00000026694

DomainStartEndE-ValueType
Pfam:Spermine_synth 73 239 1.8e-8 PFAM
Pfam:Methyltransf_18 126 234 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195027
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik A T 2: 170,579,825 M45K unknown Het
Abcd3 A G 3: 121,792,863 F63L probably damaging Het
Acsm3 A T 7: 119,768,000 M19L probably benign Het
Actn4 T C 7: 28,898,071 K41E probably benign Het
Atp8b3 T A 10: 80,526,894 I677L probably benign Het
Auh C T 13: 52,919,016 G110R probably damaging Het
Batf2 A G 19: 6,171,508 Y116C probably damaging Het
Cntn6 T C 6: 104,650,565 Y120H possibly damaging Het
Gnpat T C 8: 124,877,019 F212S probably damaging Het
Gpd1 A G 15: 99,720,607 M181V probably benign Het
Itgb3 A T 11: 104,637,088 K216N probably damaging Het
Kif21a G A 15: 90,998,005 T32M probably damaging Het
Macf1 A G 4: 123,432,584 V3477A probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh8 A G 11: 67,303,897 N1645D probably benign Het
Myo6 T C 9: 80,303,301 probably null Het
Npffr2 A T 5: 89,583,147 Y312F probably damaging Het
Pla2r1 C A 2: 60,514,968 C348F probably damaging Het
Plcb1 A G 2: 135,337,442 N590S probably damaging Het
Prpsap1 G A 11: 116,472,235 T314M probably damaging Het
Prss35 T C 9: 86,755,345 V56A probably benign Het
Setx T C 2: 29,179,898 S2572P probably benign Het
Sf3b1 T C 1: 55,016,801 D93G possibly damaging Het
Slc26a7 C A 4: 14,506,399 probably benign Het
Slc39a12 T G 2: 14,405,086 S298A probably benign Het
Sorl1 G T 9: 42,037,070 D806E probably damaging Het
Syt1 T C 10: 108,690,920 K43E possibly damaging Het
Trmt1l T A 1: 151,433,830 L88Q probably damaging Het
Zfp334 G A 2: 165,380,512 T537I probably damaging Het
Zfp574 T A 7: 25,080,057 L168* probably null Het
Other mutations in Mettl13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Mettl13 APN 1 162535865 missense possibly damaging 0.74
IGL00589:Mettl13 APN 1 162542391 missense probably damaging 1.00
IGL01765:Mettl13 APN 1 162538953 missense probably benign
IGL02200:Mettl13 APN 1 162538823 intron probably benign
IGL02835:Mettl13 UTSW 1 162546016 missense probably damaging 0.97
R0055:Mettl13 UTSW 1 162546181 missense probably damaging 1.00
R0322:Mettl13 UTSW 1 162544176 splice site probably benign
R0390:Mettl13 UTSW 1 162538889 missense possibly damaging 0.51
R0423:Mettl13 UTSW 1 162544385 missense probably damaging 1.00
R0723:Mettl13 UTSW 1 162534430 missense probably damaging 1.00
R1472:Mettl13 UTSW 1 162537167 missense possibly damaging 0.95
R3755:Mettl13 UTSW 1 162544220 missense probably damaging 0.97
R3756:Mettl13 UTSW 1 162544220 missense probably damaging 0.97
R4058:Mettl13 UTSW 1 162546186 missense probably damaging 1.00
R4059:Mettl13 UTSW 1 162546186 missense probably damaging 1.00
R4087:Mettl13 UTSW 1 162548202 missense possibly damaging 0.53
R4885:Mettl13 UTSW 1 162537268 missense probably damaging 0.99
R4974:Mettl13 UTSW 1 162537220 missense probably damaging 0.99
R5070:Mettl13 UTSW 1 162545899 missense possibly damaging 0.47
R5447:Mettl13 UTSW 1 162535880 missense probably benign 0.01
R5702:Mettl13 UTSW 1 162545980 missense probably benign 0.00
R6137:Mettl13 UTSW 1 162535886 missense probably benign 0.09
R6570:Mettl13 UTSW 1 162544286 missense probably damaging 0.99
R6754:Mettl13 UTSW 1 162548123 missense probably damaging 1.00
R7340:Mettl13 UTSW 1 162538978 missense probably benign 0.00
R7386:Mettl13 UTSW 1 162548154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTGAACTTAGTCATGACG -3'
(R):5'- GCAACTCAGAGCTCAGTGAAC -3'

Sequencing Primer
(F):5'- CCTGAACTTAGTCATGACGAAGGC -3'
(R):5'- CTCAGTGAACAACTCTATGATGTGGG -3'
Posted On2014-11-12