Incidental Mutation 'R2429:Zfp334'
ID250335
Institutional Source Beutler Lab
Gene Symbol Zfp334
Ensembl Gene ENSMUSG00000017667
Gene Namezinc finger protein 334
SynonymsD2Ertd535e
MMRRC Submission 040391-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2429 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location165374264-165388259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 165380512 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 537 (T537I)
Ref Sequence ENSEMBL: ENSMUSP00000099373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103084]
Predicted Effect probably damaging
Transcript: ENSMUST00000103084
AA Change: T537I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099373
Gene: ENSMUSG00000017667
AA Change: T537I

DomainStartEndE-ValueType
KRAB 8 68 5.91e-35 SMART
ZnF_C2H2 236 258 5.42e-2 SMART
ZnF_C2H2 264 286 1.2e-3 SMART
ZnF_C2H2 292 314 6.99e-5 SMART
ZnF_C2H2 320 342 1.22e-4 SMART
ZnF_C2H2 348 370 3.39e-3 SMART
ZnF_C2H2 376 398 7.15e-2 SMART
ZnF_C2H2 404 426 1.69e-3 SMART
ZnF_C2H2 432 454 1.92e-2 SMART
ZnF_C2H2 460 482 3.16e-3 SMART
ZnF_C2H2 543 565 1.82e-3 SMART
ZnF_C2H2 571 593 3.69e-4 SMART
ZnF_C2H2 599 621 1.58e-3 SMART
ZnF_C2H2 627 649 1.38e-3 SMART
ZnF_C2H2 655 677 3.89e-3 SMART
Meta Mutation Damage Score 0.1316 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C2H2 zinc finger family. The encoded protein contains a Krueppel-associated box, fourteen C2H2 zinc finger domains, and four C2H2-type/integrase DNA-binding domains. Decreased expression of this gene may be a marker for rheumatoid arthritis. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik A T 2: 170,579,825 M45K unknown Het
Abcd3 A G 3: 121,792,863 F63L probably damaging Het
Acsm3 A T 7: 119,768,000 M19L probably benign Het
Actn4 T C 7: 28,898,071 K41E probably benign Het
Atp8b3 T A 10: 80,526,894 I677L probably benign Het
Auh C T 13: 52,919,016 G110R probably damaging Het
Batf2 A G 19: 6,171,508 Y116C probably damaging Het
Cntn6 T C 6: 104,650,565 Y120H possibly damaging Het
Gnpat T C 8: 124,877,019 F212S probably damaging Het
Gpd1 A G 15: 99,720,607 M181V probably benign Het
Itgb3 A T 11: 104,637,088 K216N probably damaging Het
Kif21a G A 15: 90,998,005 T32M probably damaging Het
Macf1 A G 4: 123,432,584 V3477A probably damaging Het
Mettl13 A T 1: 162,546,325 L119* probably null Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh8 A G 11: 67,303,897 N1645D probably benign Het
Myo6 T C 9: 80,303,301 probably null Het
Npffr2 A T 5: 89,583,147 Y312F probably damaging Het
Pla2r1 C A 2: 60,514,968 C348F probably damaging Het
Plcb1 A G 2: 135,337,442 N590S probably damaging Het
Prpsap1 G A 11: 116,472,235 T314M probably damaging Het
Prss35 T C 9: 86,755,345 V56A probably benign Het
Setx T C 2: 29,179,898 S2572P probably benign Het
Sf3b1 T C 1: 55,016,801 D93G possibly damaging Het
Slc26a7 C A 4: 14,506,399 probably benign Het
Slc39a12 T G 2: 14,405,086 S298A probably benign Het
Sorl1 G T 9: 42,037,070 D806E probably damaging Het
Syt1 T C 10: 108,690,920 K43E possibly damaging Het
Trmt1l T A 1: 151,433,830 L88Q probably damaging Het
Zfp574 T A 7: 25,080,057 L168* probably null Het
Other mutations in Zfp334
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02097:Zfp334 APN 2 165381723 nonsense probably null
IGL02185:Zfp334 APN 2 165386949 utr 5 prime probably benign
IGL02415:Zfp334 APN 2 165381851 missense possibly damaging 0.70
IGL02693:Zfp334 APN 2 165380513 missense possibly damaging 0.80
ANU23:Zfp334 UTSW 2 165381097 missense probably damaging 1.00
R0040:Zfp334 UTSW 2 165381572 missense probably benign 0.45
R1332:Zfp334 UTSW 2 165380856 missense probably damaging 1.00
R1579:Zfp334 UTSW 2 165381799 missense probably damaging 0.98
R5556:Zfp334 UTSW 2 165380584 missense probably benign
R5579:Zfp334 UTSW 2 165380487 nonsense probably null
R6891:Zfp334 UTSW 2 165382724 missense probably benign
R6918:Zfp334 UTSW 2 165381879 missense possibly damaging 0.46
R8360:Zfp334 UTSW 2 165383358 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACTCCTTGCACTTGTGCG -3'
(R):5'- TTTCTACCTGAAGTCCACGC -3'

Sequencing Primer
(F):5'- CTTCTCGCCGGTGTGAGTC -3'
(R):5'- TGAAGTCCACGCTCACCATC -3'
Posted On2014-11-12