Incidental Mutation 'R2429:4930470P17Rik'
ID250336
Institutional Source Beutler Lab
Gene Symbol 4930470P17Rik
Ensembl Gene ENSMUSG00000043583
Gene NameRIKEN cDNA 4930470P17 gene
Synonyms
MMRRC Submission 040391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R2429 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location170579418-170602017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 170579825 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 45 (M45K)
Ref Sequence ENSEMBL: ENSMUSP00000050697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062355]
Predicted Effect unknown
Transcript: ENSMUST00000062355
AA Change: M45K
SMART Domains Protein: ENSMUSP00000050697
Gene: ENSMUSG00000043583
AA Change: M45K

DomainStartEndE-ValueType
low complexity region 89 96 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156516
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A G 3: 121,792,863 F63L probably damaging Het
Acsm3 A T 7: 119,768,000 M19L probably benign Het
Actn4 T C 7: 28,898,071 K41E probably benign Het
Atp8b3 T A 10: 80,526,894 I677L probably benign Het
Auh C T 13: 52,919,016 G110R probably damaging Het
Batf2 A G 19: 6,171,508 Y116C probably damaging Het
Cntn6 T C 6: 104,650,565 Y120H possibly damaging Het
Gnpat T C 8: 124,877,019 F212S probably damaging Het
Gpd1 A G 15: 99,720,607 M181V probably benign Het
Itgb3 A T 11: 104,637,088 K216N probably damaging Het
Kif21a G A 15: 90,998,005 T32M probably damaging Het
Macf1 A G 4: 123,432,584 V3477A probably damaging Het
Mettl13 A T 1: 162,546,325 L119* probably null Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh8 A G 11: 67,303,897 N1645D probably benign Het
Myo6 T C 9: 80,303,301 probably null Het
Npffr2 A T 5: 89,583,147 Y312F probably damaging Het
Pla2r1 C A 2: 60,514,968 C348F probably damaging Het
Plcb1 A G 2: 135,337,442 N590S probably damaging Het
Prpsap1 G A 11: 116,472,235 T314M probably damaging Het
Prss35 T C 9: 86,755,345 V56A probably benign Het
Setx T C 2: 29,179,898 S2572P probably benign Het
Sf3b1 T C 1: 55,016,801 D93G possibly damaging Het
Slc26a7 C A 4: 14,506,399 probably benign Het
Slc39a12 T G 2: 14,405,086 S298A probably benign Het
Sorl1 G T 9: 42,037,070 D806E probably damaging Het
Syt1 T C 10: 108,690,920 K43E possibly damaging Het
Trmt1l T A 1: 151,433,830 L88Q probably damaging Het
Zfp334 G A 2: 165,380,512 T537I probably damaging Het
Zfp574 T A 7: 25,080,057 L168* probably null Het
Other mutations in 4930470P17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4776:4930470P17Rik UTSW 2 170579724 missense unknown
R5119:4930470P17Rik UTSW 2 170579585 missense unknown
R7701:4930470P17Rik UTSW 2 170601305 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GTGATACATAGTCTCCAAGGGTCTG -3'
(R):5'- ACAGGCGTGTATGTATGTACAC -3'

Sequencing Primer
(F):5'- AAGGGTCTGGCGCATCTG -3'
(R):5'- ATTGGCCTCCCATTTGAAACAGG -3'
Posted On2014-11-12