Mutagenetix > Incidental Mutation

Incidental Mutation 'R2429:Cntn6'

250342

Institutional Source

Beutler Lab

Gene Symbol

Cntn6

Ensembl Gene

ENSMUSG00000030092

Gene Name

contactin 6

Synonyms

NB-3

MMRRC Submission

040391-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R2429 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104492790-104863406 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104650565 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 120 (Y120H)

Ref Sequence

ENSEMBL: ENSMUSP00000124025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]

AlphaFold

Q9JMB8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089215
AA Change: Y120H

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: Y120H

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161070
AA Change: Y48H

PolyPhen 2 Score 0.609 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: Y48H

Domain	Start	End	E-Value	Type
SCOP:d1cs6a4	4	40	5e-4	SMART
IG	57	145	2.28e-7	SMART
IGc2	168	232	4e-12	SMART
IGc2	258	321	4.52e-11	SMART
IGc2	350	414	5.48e-10	SMART
IGc2	440	512	1.44e-4	SMART
FN3	526	612	2.17e-11	SMART
FN3	629	715	8.62e0	SMART
FN3	731	816	9.92e-6	SMART
FN3	831	911	8.17e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162872
AA Change: Y120H

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: Y120H

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Meta Mutation Damage Score

0.1682

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.3%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930470P17Rik	A	T	2: 170,579,825	M45K	unknown	Het
Abcd3	A	G	3: 121,792,863	F63L	probably damaging	Het
Acsm3	A	T	7: 119,768,000	M19L	probably benign	Het
Actn4	T	C	7: 28,898,071	K41E	probably benign	Het
Atp8b3	T	A	10: 80,526,894	I677L	probably benign	Het
Auh	C	T	13: 52,919,016	G110R	probably damaging	Het
Batf2	A	G	19: 6,171,508	Y116C	probably damaging	Het
Gnpat	T	C	8: 124,877,019	F212S	probably damaging	Het
Gpd1	A	G	15: 99,720,607	M181V	probably benign	Het
Itgb3	A	T	11: 104,637,088	K216N	probably damaging	Het
Kif21a	G	A	15: 90,998,005	T32M	probably damaging	Het
Macf1	A	G	4: 123,432,584	V3477A	probably damaging	Het
Mettl13	A	T	1: 162,546,325	L119*	probably null	Het
Myg1	G	C	15: 102,337,736	G349R	probably damaging	Het
Myh8	A	G	11: 67,303,897	N1645D	probably benign	Het
Myo6	T	C	9: 80,303,301		probably null	Het
Npffr2	A	T	5: 89,583,147	Y312F	probably damaging	Het
Pla2r1	C	A	2: 60,514,968	C348F	probably damaging	Het
Plcb1	A	G	2: 135,337,442	N590S	probably damaging	Het
Prpsap1	G	A	11: 116,472,235	T314M	probably damaging	Het
Prss35	T	C	9: 86,755,345	V56A	probably benign	Het
Setx	T	C	2: 29,179,898	S2572P	probably benign	Het
Sf3b1	T	C	1: 55,016,801	D93G	possibly damaging	Het
Slc26a7	C	A	4: 14,506,399		probably benign	Het
Slc39a12	T	G	2: 14,405,086	S298A	probably benign	Het
Sorl1	G	T	9: 42,037,070	D806E	probably damaging	Het
Syt1	T	C	10: 108,690,920	K43E	possibly damaging	Het
Trmt1l	T	A	1: 151,433,830	L88Q	probably damaging	Het
Zfp334	G	A	2: 165,380,512	T537I	probably damaging	Het
Zfp574	T	A	7: 25,080,057	L168*	probably null	Het

Other mutations in Cntn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Cntn6	APN	6	104650400	missense	probably damaging	0.99
IGL01331:Cntn6	APN	6	104774523	missense	probably damaging	1.00
IGL01619:Cntn6	APN	6	104728374	splice site	probably benign
IGL02028:Cntn6	APN	6	104859426	missense	probably damaging	0.99
IGL02420:Cntn6	APN	6	104846142	critical splice donor site	probably null
IGL02557:Cntn6	APN	6	104774535	missense	probably damaging	1.00
IGL03000:Cntn6	APN	6	104804386	missense	probably damaging	1.00
IGL03367:Cntn6	APN	6	104804338	missense	probably damaging	1.00
IGL03383:Cntn6	APN	6	104776457	splice site	probably benign
PIT4366001:Cntn6	UTSW	6	104832537	missense	probably benign	0.05
R0490:Cntn6	UTSW	6	104833918	missense	possibly damaging	0.91
R0583:Cntn6	UTSW	6	104776314	missense	possibly damaging	0.79
R0636:Cntn6	UTSW	6	104863148	missense	probably benign	0.00
R0654:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R0960:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R1241:Cntn6	UTSW	6	104832509	missense	probably damaging	1.00
R1385:Cntn6	UTSW	6	104861900	missense	probably benign	0.07
R1401:Cntn6	UTSW	6	104804398	missense	possibly damaging	0.65
R1478:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R1542:Cntn6	UTSW	6	104848100	missense	probably damaging	1.00
R1593:Cntn6	UTSW	6	104832580	missense	possibly damaging	0.58
R1840:Cntn6	UTSW	6	104774480	missense	probably damaging	1.00
R2066:Cntn6	UTSW	6	104861822	nonsense	probably null
R2097:Cntn6	UTSW	6	104861949	missense	probably damaging	0.99
R2289:Cntn6	UTSW	6	104569028	start gained	probably benign
R2967:Cntn6	UTSW	6	104726237	missense	probably benign	0.04
R4009:Cntn6	UTSW	6	104833822	missense	probably damaging	0.98
R4476:Cntn6	UTSW	6	104772561	missense	probably damaging	1.00
R4664:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4666:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4701:Cntn6	UTSW	6	104804360	missense	probably benign	0.01
R4780:Cntn6	UTSW	6	104845784	missense	probably damaging	1.00
R4854:Cntn6	UTSW	6	104859475	missense	possibly damaging	0.95
R4965:Cntn6	UTSW	6	104774474	missense	probably damaging	0.99
R5051:Cntn6	UTSW	6	104772597	missense	probably damaging	1.00
R5075:Cntn6	UTSW	6	104833030	missense	probably damaging	1.00
R5152:Cntn6	UTSW	6	104569113	intron	probably benign
R5291:Cntn6	UTSW	6	104726135	missense	probably damaging	1.00
R5388:Cntn6	UTSW	6	104832562	missense	probably damaging	1.00
R5852:Cntn6	UTSW	6	104835745	missense	probably damaging	0.97
R5937:Cntn6	UTSW	6	104833103	missense	possibly damaging	0.68
R5980:Cntn6	UTSW	6	104848132	missense	probably damaging	0.98
R6290:Cntn6	UTSW	6	104767890	missense	probably damaging	1.00
R6338:Cntn6	UTSW	6	104726139	missense	probably damaging	1.00
R6396:Cntn6	UTSW	6	104650500	missense	probably damaging	1.00
R6447:Cntn6	UTSW	6	104859448	missense	probably damaging	1.00
R6860:Cntn6	UTSW	6	104861946	missense	possibly damaging	0.95
R6871:Cntn6	UTSW	6	104845758	frame shift	probably null
R7012:Cntn6	UTSW	6	104726262	missense	probably damaging	0.98
R7012:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R7337:Cntn6	UTSW	6	104650530	missense	probably damaging	0.99
R7658:Cntn6	UTSW	6	104650483	missense	probably benign	0.29
R8133:Cntn6	UTSW	6	104728337	missense	probably benign	0.19
R8463:Cntn6	UTSW	6	104772619	missense	possibly damaging	0.64
R8909:Cntn6	UTSW	6	104848132	missense	probably benign	0.05
R9232:Cntn6	UTSW	6	104838820	missense	probably damaging	1.00
R9287:Cntn6	UTSW	6	104832510	missense	possibly damaging	0.89
R9454:Cntn6	UTSW	6	104804347	missense	possibly damaging	0.82
R9698:Cntn6	UTSW	6	104833083	nonsense	probably null
X0020:Cntn6	UTSW	6	104767884	missense	probably benign	0.00
Z1177:Cntn6	UTSW	6	104832584	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCTTGAAGGTGGAAACAGAATGGTAC -3'
(R):5'- AGAGATTGTTCCAAGATTCCTTCAC -3'

Sequencing Primer
(F):5'- GGTACAGATATTGACTTCGGCATGAC -3'
(R):5'- CGAGGATGTTACTGAGAAC -3'

Posted On

2014-11-12