Incidental Mutation 'R2429:Cntn6'
ID250342
Institutional Source Beutler Lab
Gene Symbol Cntn6
Ensembl Gene ENSMUSG00000030092
Gene Namecontactin 6
SynonymsNB-3
MMRRC Submission 040391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R2429 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location104492790-104863406 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104650565 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 120 (Y120H)
Ref Sequence ENSEMBL: ENSMUSP00000124025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089215
AA Change: Y120H

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: Y120H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161070
AA Change: Y48H

PolyPhen 2 Score 0.609 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: Y48H

DomainStartEndE-ValueType
SCOP:d1cs6a4 4 40 5e-4 SMART
IG 57 145 2.28e-7 SMART
IGc2 168 232 4e-12 SMART
IGc2 258 321 4.52e-11 SMART
IGc2 350 414 5.48e-10 SMART
IGc2 440 512 1.44e-4 SMART
FN3 526 612 2.17e-11 SMART
FN3 629 715 8.62e0 SMART
FN3 731 816 9.92e-6 SMART
FN3 831 911 8.17e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162872
AA Change: Y120H

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: Y120H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Meta Mutation Damage Score 0.1682 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik A T 2: 170,579,825 M45K unknown Het
Abcd3 A G 3: 121,792,863 F63L probably damaging Het
Acsm3 A T 7: 119,768,000 M19L probably benign Het
Actn4 T C 7: 28,898,071 K41E probably benign Het
Atp8b3 T A 10: 80,526,894 I677L probably benign Het
Auh C T 13: 52,919,016 G110R probably damaging Het
Batf2 A G 19: 6,171,508 Y116C probably damaging Het
Gnpat T C 8: 124,877,019 F212S probably damaging Het
Gpd1 A G 15: 99,720,607 M181V probably benign Het
Itgb3 A T 11: 104,637,088 K216N probably damaging Het
Kif21a G A 15: 90,998,005 T32M probably damaging Het
Macf1 A G 4: 123,432,584 V3477A probably damaging Het
Mettl13 A T 1: 162,546,325 L119* probably null Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh8 A G 11: 67,303,897 N1645D probably benign Het
Myo6 T C 9: 80,303,301 probably null Het
Npffr2 A T 5: 89,583,147 Y312F probably damaging Het
Pla2r1 C A 2: 60,514,968 C348F probably damaging Het
Plcb1 A G 2: 135,337,442 N590S probably damaging Het
Prpsap1 G A 11: 116,472,235 T314M probably damaging Het
Prss35 T C 9: 86,755,345 V56A probably benign Het
Setx T C 2: 29,179,898 S2572P probably benign Het
Sf3b1 T C 1: 55,016,801 D93G possibly damaging Het
Slc26a7 C A 4: 14,506,399 probably benign Het
Slc39a12 T G 2: 14,405,086 S298A probably benign Het
Sorl1 G T 9: 42,037,070 D806E probably damaging Het
Syt1 T C 10: 108,690,920 K43E possibly damaging Het
Trmt1l T A 1: 151,433,830 L88Q probably damaging Het
Zfp334 G A 2: 165,380,512 T537I probably damaging Het
Zfp574 T A 7: 25,080,057 L168* probably null Het
Other mutations in Cntn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Cntn6 APN 6 104650400 missense probably damaging 0.99
IGL01331:Cntn6 APN 6 104774523 missense probably damaging 1.00
IGL01619:Cntn6 APN 6 104728374 splice site probably benign
IGL02028:Cntn6 APN 6 104859426 missense probably damaging 0.99
IGL02420:Cntn6 APN 6 104846142 critical splice donor site probably null
IGL02557:Cntn6 APN 6 104774535 missense probably damaging 1.00
IGL03000:Cntn6 APN 6 104804386 missense probably damaging 1.00
IGL03367:Cntn6 APN 6 104804338 missense probably damaging 1.00
IGL03383:Cntn6 APN 6 104776457 splice site probably benign
PIT4366001:Cntn6 UTSW 6 104832537 missense probably benign 0.05
R0490:Cntn6 UTSW 6 104833918 missense possibly damaging 0.91
R0583:Cntn6 UTSW 6 104776314 missense possibly damaging 0.79
R0636:Cntn6 UTSW 6 104863148 missense probably benign 0.00
R0654:Cntn6 UTSW 6 104776428 missense probably benign 0.00
R0960:Cntn6 UTSW 6 104774480 missense probably benign 0.01
R1241:Cntn6 UTSW 6 104832509 missense probably damaging 1.00
R1385:Cntn6 UTSW 6 104861900 missense probably benign 0.07
R1401:Cntn6 UTSW 6 104804398 missense possibly damaging 0.65
R1478:Cntn6 UTSW 6 104776428 missense probably benign 0.00
R1542:Cntn6 UTSW 6 104848100 missense probably damaging 1.00
R1593:Cntn6 UTSW 6 104832580 missense possibly damaging 0.58
R1840:Cntn6 UTSW 6 104774480 missense probably damaging 1.00
R2066:Cntn6 UTSW 6 104861822 nonsense probably null
R2097:Cntn6 UTSW 6 104861949 missense probably damaging 0.99
R2289:Cntn6 UTSW 6 104569028 start gained probably benign
R2967:Cntn6 UTSW 6 104726237 missense probably benign 0.04
R4009:Cntn6 UTSW 6 104833822 missense probably damaging 0.98
R4476:Cntn6 UTSW 6 104772561 missense probably damaging 1.00
R4664:Cntn6 UTSW 6 104728284 missense probably benign 0.20
R4666:Cntn6 UTSW 6 104728284 missense probably benign 0.20
R4701:Cntn6 UTSW 6 104804360 missense probably benign 0.01
R4780:Cntn6 UTSW 6 104845784 missense probably damaging 1.00
R4854:Cntn6 UTSW 6 104859475 missense possibly damaging 0.95
R4965:Cntn6 UTSW 6 104774474 missense probably damaging 0.99
R5051:Cntn6 UTSW 6 104772597 missense probably damaging 1.00
R5075:Cntn6 UTSW 6 104833030 missense probably damaging 1.00
R5152:Cntn6 UTSW 6 104569113 intron probably benign
R5291:Cntn6 UTSW 6 104726135 missense probably damaging 1.00
R5388:Cntn6 UTSW 6 104832562 missense probably damaging 1.00
R5852:Cntn6 UTSW 6 104835745 missense probably damaging 0.97
R5937:Cntn6 UTSW 6 104833103 missense possibly damaging 0.68
R5980:Cntn6 UTSW 6 104848132 missense probably damaging 0.98
R6290:Cntn6 UTSW 6 104767890 missense probably damaging 1.00
R6338:Cntn6 UTSW 6 104726139 missense probably damaging 1.00
R6396:Cntn6 UTSW 6 104650500 missense probably damaging 1.00
R6447:Cntn6 UTSW 6 104859448 missense probably damaging 1.00
R6860:Cntn6 UTSW 6 104861946 missense possibly damaging 0.95
R6871:Cntn6 UTSW 6 104845758 frame shift probably null
R7012:Cntn6 UTSW 6 104726262 missense probably damaging 0.98
R7012:Cntn6 UTSW 6 104774480 missense probably benign 0.01
R7337:Cntn6 UTSW 6 104650530 missense probably damaging 0.99
R7658:Cntn6 UTSW 6 104650483 missense probably benign 0.29
R8133:Cntn6 UTSW 6 104728337 missense probably benign 0.19
R8463:Cntn6 UTSW 6 104772619 missense possibly damaging 0.64
X0020:Cntn6 UTSW 6 104767884 missense probably benign 0.00
Z1177:Cntn6 UTSW 6 104832584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTTGAAGGTGGAAACAGAATGGTAC -3'
(R):5'- AGAGATTGTTCCAAGATTCCTTCAC -3'

Sequencing Primer
(F):5'- GGTACAGATATTGACTTCGGCATGAC -3'
(R):5'- CGAGGATGTTACTGAGAAC -3'
Posted On2014-11-12