Incidental Mutation 'R2429:Prss35'
ID250349
Institutional Source Beutler Lab
Gene Symbol Prss35
Ensembl Gene ENSMUSG00000033491
Gene Nameprotease, serine 35
Synonyms6030424L22Rik
MMRRC Submission 040391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R2429 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location86743649-86758443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86755345 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 56 (V56A)
Ref Sequence ENSEMBL: ENSMUSP00000137445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036426] [ENSMUST00000179574]
Predicted Effect probably benign
Transcript: ENSMUST00000036426
AA Change: V56A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035271
Gene: ENSMUSG00000033491
AA Change: V56A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
Tryp_SPc 132 399 4.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179574
AA Change: V56A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137445
Gene: ENSMUSG00000033491
AA Change: V56A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
Tryp_SPc 132 399 4.13e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik A T 2: 170,579,825 M45K unknown Het
Abcd3 A G 3: 121,792,863 F63L probably damaging Het
Acsm3 A T 7: 119,768,000 M19L probably benign Het
Actn4 T C 7: 28,898,071 K41E probably benign Het
Atp8b3 T A 10: 80,526,894 I677L probably benign Het
Auh C T 13: 52,919,016 G110R probably damaging Het
Batf2 A G 19: 6,171,508 Y116C probably damaging Het
Cntn6 T C 6: 104,650,565 Y120H possibly damaging Het
Gnpat T C 8: 124,877,019 F212S probably damaging Het
Gpd1 A G 15: 99,720,607 M181V probably benign Het
Itgb3 A T 11: 104,637,088 K216N probably damaging Het
Kif21a G A 15: 90,998,005 T32M probably damaging Het
Macf1 A G 4: 123,432,584 V3477A probably damaging Het
Mettl13 A T 1: 162,546,325 L119* probably null Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh8 A G 11: 67,303,897 N1645D probably benign Het
Myo6 T C 9: 80,303,301 probably null Het
Npffr2 A T 5: 89,583,147 Y312F probably damaging Het
Pla2r1 C A 2: 60,514,968 C348F probably damaging Het
Plcb1 A G 2: 135,337,442 N590S probably damaging Het
Prpsap1 G A 11: 116,472,235 T314M probably damaging Het
Setx T C 2: 29,179,898 S2572P probably benign Het
Sf3b1 T C 1: 55,016,801 D93G possibly damaging Het
Slc26a7 C A 4: 14,506,399 probably benign Het
Slc39a12 T G 2: 14,405,086 S298A probably benign Het
Sorl1 G T 9: 42,037,070 D806E probably damaging Het
Syt1 T C 10: 108,690,920 K43E possibly damaging Het
Trmt1l T A 1: 151,433,830 L88Q probably damaging Het
Zfp334 G A 2: 165,380,512 T537I probably damaging Het
Zfp574 T A 7: 25,080,057 L168* probably null Het
Other mutations in Prss35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Prss35 APN 9 86755274 missense probably benign 0.00
IGL02749:Prss35 APN 9 86756244 missense probably damaging 1.00
R0346:Prss35 UTSW 9 86755351 missense probably benign 0.04
R0403:Prss35 UTSW 9 86756037 missense probably damaging 1.00
R1664:Prss35 UTSW 9 86755647 missense probably benign 0.29
R2016:Prss35 UTSW 9 86755512 missense probably benign 0.37
R2017:Prss35 UTSW 9 86755512 missense probably benign 0.37
R2325:Prss35 UTSW 9 86756304 missense probably damaging 1.00
R2965:Prss35 UTSW 9 86755582 missense probably damaging 1.00
R2966:Prss35 UTSW 9 86755582 missense probably damaging 1.00
R3961:Prss35 UTSW 9 86755749 missense probably benign 0.02
R4792:Prss35 UTSW 9 86755669 missense probably damaging 1.00
R4902:Prss35 UTSW 9 86756122 missense probably damaging 1.00
R6169:Prss35 UTSW 9 86755438 missense probably benign 0.00
R6446:Prss35 UTSW 9 86755653 missense probably damaging 0.99
R6753:Prss35 UTSW 9 86756100 missense probably damaging 1.00
R7008:Prss35 UTSW 9 86756308 missense probably benign 0.01
R7387:Prss35 UTSW 9 86755921 missense probably damaging 1.00
R7523:Prss35 UTSW 9 86755374 missense probably damaging 1.00
R7587:Prss35 UTSW 9 86755374 missense probably damaging 1.00
R7652:Prss35 UTSW 9 86755970 missense probably benign
R8013:Prss35 UTSW 9 86755425 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTCAGGACCTAAGGCATAAAGG -3'
(R):5'- TTACGCTGCTGTTCCGAGTG -3'

Sequencing Primer
(F):5'- ATACTTAAAACCACTCTTTCTTTCCC -3'
(R):5'- AGTGGGTTCCAGGACCAGAC -3'
Posted On2014-11-12