Mutagenetix > Incidental Mutation

Incidental Mutation 'R2429:Atp8b3'

250350

Institutional Source

Beutler Lab

Gene Symbol

Atp8b3

Ensembl Gene

ENSMUSG00000003341

Gene Name

ATPase, class I, type 8B, member 3

Synonyms

1700042F02Rik, SAPLT, 1700056N23Rik

MMRRC Submission

040391-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R2429 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80519584-80539124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80526894 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 677 (I677L)

Ref Sequence

ENSEMBL: ENSMUSP00000151571 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]

AlphaFold

Q6UQ17

Predicted Effect

probably benign
Transcript: ENSMUST00000020383
AA Change: I677L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: I677L

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	20	97	9.3e-29	PFAM
Pfam:E1-E2_ATPase	121	367	2.2e-10	PFAM
Pfam:HAD	404	866	3.7e-17	PFAM
Pfam:Cation_ATPase	481	580	8.3e-12	PFAM
Pfam:PhoLip_ATPase_C	883	1135	4.2e-61	PFAM
low complexity region	1140	1153	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220326
AA Change: I677L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

Meta Mutation Damage Score

0.0862

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.3%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930470P17Rik	A	T	2: 170,579,825	M45K	unknown	Het
Abcd3	A	G	3: 121,792,863	F63L	probably damaging	Het
Acsm3	A	T	7: 119,768,000	M19L	probably benign	Het
Actn4	T	C	7: 28,898,071	K41E	probably benign	Het
Auh	C	T	13: 52,919,016	G110R	probably damaging	Het
Batf2	A	G	19: 6,171,508	Y116C	probably damaging	Het
Cntn6	T	C	6: 104,650,565	Y120H	possibly damaging	Het
Gnpat	T	C	8: 124,877,019	F212S	probably damaging	Het
Gpd1	A	G	15: 99,720,607	M181V	probably benign	Het
Itgb3	A	T	11: 104,637,088	K216N	probably damaging	Het
Kif21a	G	A	15: 90,998,005	T32M	probably damaging	Het
Macf1	A	G	4: 123,432,584	V3477A	probably damaging	Het
Mettl13	A	T	1: 162,546,325	L119*	probably null	Het
Myg1	G	C	15: 102,337,736	G349R	probably damaging	Het
Myh8	A	G	11: 67,303,897	N1645D	probably benign	Het
Myo6	T	C	9: 80,303,301		probably null	Het
Npffr2	A	T	5: 89,583,147	Y312F	probably damaging	Het
Pla2r1	C	A	2: 60,514,968	C348F	probably damaging	Het
Plcb1	A	G	2: 135,337,442	N590S	probably damaging	Het
Prpsap1	G	A	11: 116,472,235	T314M	probably damaging	Het
Prss35	T	C	9: 86,755,345	V56A	probably benign	Het
Setx	T	C	2: 29,179,898	S2572P	probably benign	Het
Sf3b1	T	C	1: 55,016,801	D93G	possibly damaging	Het
Slc26a7	C	A	4: 14,506,399		probably benign	Het
Slc39a12	T	G	2: 14,405,086	S298A	probably benign	Het
Sorl1	G	T	9: 42,037,070	D806E	probably damaging	Het
Syt1	T	C	10: 108,690,920	K43E	possibly damaging	Het
Trmt1l	T	A	1: 151,433,830	L88Q	probably damaging	Het
Zfp334	G	A	2: 165,380,512	T537I	probably damaging	Het
Zfp574	T	A	7: 25,080,057	L168*	probably null	Het

Other mutations in Atp8b3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Atp8b3	APN	10	80530987	missense	probably damaging	1.00
IGL00484:Atp8b3	APN	10	80526164	splice site	probably benign
IGL00904:Atp8b3	APN	10	80528764	missense	probably damaging	1.00
IGL01326:Atp8b3	APN	10	80524376	missense	probably damaging	0.98
IGL01368:Atp8b3	APN	10	80534229	splice site	probably benign
IGL01448:Atp8b3	APN	10	80520422	missense	probably benign	0.02
IGL01556:Atp8b3	APN	10	80530968	nonsense	probably null
IGL01754:Atp8b3	APN	10	80530961	splice site	probably null
IGL01809:Atp8b3	APN	10	80520011	missense	probably benign	0.02
IGL01895:Atp8b3	APN	10	80521828	missense	possibly damaging	0.80
IGL02184:Atp8b3	APN	10	80527233	splice site	probably benign
IGL02224:Atp8b3	APN	10	80525976	splice site	probably benign
IGL02377:Atp8b3	APN	10	80520294	missense	probably benign	0.06
IGL02405:Atp8b3	APN	10	80530628	missense	probably damaging	1.00
IGL03090:Atp8b3	APN	10	80530604	missense	probably damaging	1.00
IGL03244:Atp8b3	APN	10	80534458	missense	probably damaging	1.00
PIT4544001:Atp8b3	UTSW	10	80530586	missense	probably benign	0.14
R0277:Atp8b3	UTSW	10	80526909	missense	probably benign	0.21
R0908:Atp8b3	UTSW	10	80520084	missense	probably benign	0.03
R0973:Atp8b3	UTSW	10	80534198	missense	probably damaging	1.00
R1069:Atp8b3	UTSW	10	80531018	missense	probably damaging	1.00
R1087:Atp8b3	UTSW	10	80520183	missense	probably benign	0.00
R1553:Atp8b3	UTSW	10	80532542	missense	probably damaging	1.00
R1603:Atp8b3	UTSW	10	80525785	missense	probably benign	0.06
R1606:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R1707:Atp8b3	UTSW	10	80521801	splice site	probably null
R1717:Atp8b3	UTSW	10	80528797	missense	probably damaging	1.00
R1876:Atp8b3	UTSW	10	80530078	missense	possibly damaging	0.70
R1939:Atp8b3	UTSW	10	80525386	nonsense	probably null
R2138:Atp8b3	UTSW	10	80527105	missense	possibly damaging	0.79
R2239:Atp8b3	UTSW	10	80530988	missense	probably damaging	1.00
R2696:Atp8b3	UTSW	10	80534183	missense	possibly damaging	0.94
R2910:Atp8b3	UTSW	10	80519912	missense	possibly damaging	0.90
R3424:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3425:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3432:Atp8b3	UTSW	10	80526180	missense	probably benign	0.10
R3841:Atp8b3	UTSW	10	80529706	missense	possibly damaging	0.95
R4515:Atp8b3	UTSW	10	80523847	missense	probably benign
R4518:Atp8b3	UTSW	10	80523847	missense	probably benign
R4519:Atp8b3	UTSW	10	80523847	missense	probably benign
R4619:Atp8b3	UTSW	10	80526024	missense	possibly damaging	0.67
R4648:Atp8b3	UTSW	10	80525623	missense	possibly damaging	0.94
R4709:Atp8b3	UTSW	10	80536770	splice site	probably null
R4774:Atp8b3	UTSW	10	80536322	missense	probably damaging	1.00
R4796:Atp8b3	UTSW	10	80524354	missense	probably damaging	1.00
R5000:Atp8b3	UTSW	10	80521842	missense	possibly damaging	0.82
R5398:Atp8b3	UTSW	10	80529699	missense	probably damaging	1.00
R5778:Atp8b3	UTSW	10	80520173	missense	probably benign
R5990:Atp8b3	UTSW	10	80525697	missense	possibly damaging	0.65
R6124:Atp8b3	UTSW	10	80529681	missense	probably damaging	1.00
R6427:Atp8b3	UTSW	10	80520323	splice site	probably null
R6748:Atp8b3	UTSW	10	80525224	missense	possibly damaging	0.56
R6756:Atp8b3	UTSW	10	80526061	missense	possibly damaging	0.76
R7051:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7051:Atp8b3	UTSW	10	80529718	missense	probably damaging	0.99
R7052:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7418:Atp8b3	UTSW	10	80530092	missense	probably damaging	0.99
R7426:Atp8b3	UTSW	10	80529629	critical splice donor site	probably null
R7625:Atp8b3	UTSW	10	80520146	missense	probably benign	0.00
R7673:Atp8b3	UTSW	10	80524406	missense	probably damaging	0.99
R7921:Atp8b3	UTSW	10	80530603	missense	probably damaging	1.00
R8077:Atp8b3	UTSW	10	80531024	missense	possibly damaging	0.95
R8235:Atp8b3	UTSW	10	80529816	missense	probably damaging	0.96
R8354:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8454:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8501:Atp8b3	UTSW	10	80520146	missense	probably benign
R8712:Atp8b3	UTSW	10	80530089	missense	possibly damaging	0.52
R8962:Atp8b3	UTSW	10	80520062	missense	probably benign	0.13
R9129:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R9333:Atp8b3	UTSW	10	80524346	missense	probably benign	0.01
R9438:Atp8b3	UTSW	10	80525575	missense	probably damaging	1.00
R9486:Atp8b3	UTSW	10	80530987	missense	probably damaging	1.00
R9554:Atp8b3	UTSW	10	80524363	missense	probably damaging	1.00
R9570:Atp8b3	UTSW	10	80525988	missense	probably benign	0.05
R9682:Atp8b3	UTSW	10	80535396	missense	probably damaging	1.00
R9748:Atp8b3	UTSW	10	80528573	missense	probably damaging	0.96
RF006:Atp8b3	UTSW	10	80526236	missense	probably benign	0.15
Z1177:Atp8b3	UTSW	10	80531077	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ATCCCTTCAACGCTGACCTG -3'
(R):5'- CCTGCACCAGGTGTATAATAAGATG -3'

Sequencing Primer
(F):5'- CCTGGAGGTCACTTTAGGATAG -3'
(R):5'- ACCTTGGTACCTGAACCT -3'

Posted On

2014-11-12