Incidental Mutation 'R2429:Itgb3'
ID250353
Institutional Source Beutler Lab
Gene Symbol Itgb3
Ensembl Gene ENSMUSG00000020689
Gene Nameintegrin beta 3
SynonymsCD61, platelet glycoprotein IIIa (GP3A)
MMRRC Submission 040391-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock #R2429 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104608000-104670476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104637088 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 216 (K216N)
Ref Sequence ENSEMBL: ENSMUSP00000021028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021028]
Predicted Effect probably damaging
Transcript: ENSMUST00000021028
AA Change: K216N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021028
Gene: ENSMUSG00000020689
AA Change: K216N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
PSI 29 75 4.43e-5 SMART
INB 37 460 3.16e-276 SMART
VWA 136 395 8.65e-2 SMART
Pfam:EGF_2 511 546 6.8e-7 PFAM
Pfam:EGF_2 553 583 8.1e-7 PFAM
Integrin_B_tail 633 717 1.07e-28 SMART
Integrin_b_cyt 741 787 1.78e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127140
Meta Mutation Damage Score 0.8388 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ITGB3 protein product is the integrin beta chain beta 3. Integrins are integral cell-surface proteins composed of an alpha chain and a beta chain. A given chain may combine with multiple partners resulting in different integrins. Integrin beta 3 is found along with the alpha IIb chain in platelets. Integrins are known to participate in cell adhesion as well as cell-surface mediated signalling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit platelet defects, extended bleeding times, cutaneous and gastrointestinal bleeding, anemia, increased bone mass, hypocalcemia, reduced survival, and placental defects associated with some fetal loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik A T 2: 170,579,825 M45K unknown Het
Abcd3 A G 3: 121,792,863 F63L probably damaging Het
Acsm3 A T 7: 119,768,000 M19L probably benign Het
Actn4 T C 7: 28,898,071 K41E probably benign Het
Atp8b3 T A 10: 80,526,894 I677L probably benign Het
Auh C T 13: 52,919,016 G110R probably damaging Het
Batf2 A G 19: 6,171,508 Y116C probably damaging Het
Cntn6 T C 6: 104,650,565 Y120H possibly damaging Het
Gnpat T C 8: 124,877,019 F212S probably damaging Het
Gpd1 A G 15: 99,720,607 M181V probably benign Het
Kif21a G A 15: 90,998,005 T32M probably damaging Het
Macf1 A G 4: 123,432,584 V3477A probably damaging Het
Mettl13 A T 1: 162,546,325 L119* probably null Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh8 A G 11: 67,303,897 N1645D probably benign Het
Myo6 T C 9: 80,303,301 probably null Het
Npffr2 A T 5: 89,583,147 Y312F probably damaging Het
Pla2r1 C A 2: 60,514,968 C348F probably damaging Het
Plcb1 A G 2: 135,337,442 N590S probably damaging Het
Prpsap1 G A 11: 116,472,235 T314M probably damaging Het
Prss35 T C 9: 86,755,345 V56A probably benign Het
Setx T C 2: 29,179,898 S2572P probably benign Het
Sf3b1 T C 1: 55,016,801 D93G possibly damaging Het
Slc26a7 C A 4: 14,506,399 probably benign Het
Slc39a12 T G 2: 14,405,086 S298A probably benign Het
Sorl1 G T 9: 42,037,070 D806E probably damaging Het
Syt1 T C 10: 108,690,920 K43E possibly damaging Het
Trmt1l T A 1: 151,433,830 L88Q probably damaging Het
Zfp334 G A 2: 165,380,512 T537I probably damaging Het
Zfp574 T A 7: 25,080,057 L168* probably null Het
Other mutations in Itgb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Itgb3 APN 11 104633584 missense probably damaging 1.00
IGL01460:Itgb3 APN 11 104662394 nonsense probably null
IGL01615:Itgb3 APN 11 104643965 missense probably damaging 1.00
IGL01669:Itgb3 APN 11 104633390 splice site probably benign
IGL02057:Itgb3 APN 11 104632348 missense probably damaging 1.00
IGL02192:Itgb3 APN 11 104643939 missense probably benign
IGL02604:Itgb3 APN 11 104662443 missense probably damaging 0.99
IGL02708:Itgb3 APN 11 104637829 missense possibly damaging 0.60
IGL02901:Itgb3 APN 11 104637946 missense probably benign 0.18
IGL03288:Itgb3 APN 11 104633467 missense probably damaging 1.00
R0042:Itgb3 UTSW 11 104667140 missense possibly damaging 0.80
R0042:Itgb3 UTSW 11 104667140 missense possibly damaging 0.80
R0123:Itgb3 UTSW 11 104637088 missense probably damaging 1.00
R0125:Itgb3 UTSW 11 104643963 missense probably damaging 1.00
R0637:Itgb3 UTSW 11 104658876 missense probably benign 0.02
R2017:Itgb3 UTSW 11 104637962 missense possibly damaging 0.70
R2045:Itgb3 UTSW 11 104623413 missense probably benign
R2200:Itgb3 UTSW 11 104640986 splice site probably null
R2225:Itgb3 UTSW 11 104665510 missense probably benign 0.00
R3820:Itgb3 UTSW 11 104633612 nonsense probably null
R4863:Itgb3 UTSW 11 104665520 missense probably damaging 1.00
R5116:Itgb3 UTSW 11 104641077 missense probably benign 0.20
R5301:Itgb3 UTSW 11 104633654 splice site probably null
R5933:Itgb3 UTSW 11 104637979 missense possibly damaging 0.63
R6361:Itgb3 UTSW 11 104665582 missense possibly damaging 0.72
R6436:Itgb3 UTSW 11 104633492 missense probably damaging 0.99
R6452:Itgb3 UTSW 11 104633464 nonsense probably null
R7196:Itgb3 UTSW 11 104633612 nonsense probably null
R7438:Itgb3 UTSW 11 104643577 missense possibly damaging 0.90
R8006:Itgb3 UTSW 11 104665496 missense possibly damaging 0.56
R8068:Itgb3 UTSW 11 104665511 missense probably benign 0.35
Z1176:Itgb3 UTSW 11 104643623 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CAGACACAGGTACACACAGAGAT -3'
(R):5'- CAAAGTCCCGTGTGGTTCCC -3'

Sequencing Primer
(F):5'- GACACACATTCAGAGACACAGAG -3'
(R):5'- GGAAACCCCCAAGTGAACTGTTTC -3'
Posted On2014-11-12