Incidental Mutation 'R2429:Auh'
ID250355
Institutional Source Beutler Lab
Gene Symbol Auh
Ensembl Gene ENSMUSG00000021460
Gene NameAU RNA binding protein/enoyl-coenzyme A hydratase
SynonymsW91705
MMRRC Submission 040391-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2429 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location52835119-52929681 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 52919016 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 110 (G110R)
Ref Sequence ENSEMBL: ENSMUSP00000113659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021913] [ENSMUST00000110031] [ENSMUST00000119311] [ENSMUST00000120535] [ENSMUST00000123599]
Predicted Effect probably damaging
Transcript: ENSMUST00000021913
AA Change: G110R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021913
Gene: ENSMUSG00000021460
AA Change: G110R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ECH_1 59 314 4.5e-62 PFAM
Pfam:ECH_2 64 248 1.6e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110031
AA Change: G110R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105658
Gene: ENSMUSG00000021460
AA Change: G110R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ECH 57 120 5.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119311
AA Change: G110R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113659
Gene: ENSMUSG00000021460
AA Change: G110R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ECH_1 59 115 2.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120535
AA Change: G110R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112427
Gene: ENSMUSG00000021460
AA Change: G110R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ECH_1 59 142 1.3e-15 PFAM
Pfam:ECH_2 64 139 3.5e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123599
AA Change: G71R

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116179
Gene: ENSMUSG00000021460
AA Change: G71R

DomainStartEndE-ValueType
Pfam:ECH_1 21 217 1.7e-48 PFAM
Pfam:ECH_2 25 211 9.8e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133906
Predicted Effect unknown
Transcript: ENSMUST00000137064
AA Change: G36R
SMART Domains Protein: ENSMUSP00000121852
Gene: ENSMUSG00000021460
AA Change: G36R

DomainStartEndE-ValueType
Pfam:ECH_2 1 179 1.9e-28 PFAM
Pfam:ECH_1 1 236 1.1e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153329
Meta Mutation Damage Score 0.3994 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes bifunctional mitochondrial protein that has both RNA-binding and hydratase activities. The encoded protein is a methylglutaconyl-CoA hydratase that catalyzes the hydration of 3-methylglutaconyl-CoA to 3-hydroxy-3-methyl-glutaryl-CoA, a critical step in the leucine degradation pathway. This protein also binds AU-rich elements (AREs) found in the 3' UTRs of rapidly decaying mRNAs including c-fos, c-myc and granulocyte/ macrophage colony stimulating factor. ARE elements are involved in directing RNA to rapid degradation and deadenylation. This protein is localizes to the mitochondrial matrix and the inner mitochondrial membrane and may be involved in mitochondrial protein synthesis. Mutations in this gene are the cause of 3-methylglutaconic aciduria, type I. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik A T 2: 170,579,825 M45K unknown Het
Abcd3 A G 3: 121,792,863 F63L probably damaging Het
Acsm3 A T 7: 119,768,000 M19L probably benign Het
Actn4 T C 7: 28,898,071 K41E probably benign Het
Atp8b3 T A 10: 80,526,894 I677L probably benign Het
Batf2 A G 19: 6,171,508 Y116C probably damaging Het
Cntn6 T C 6: 104,650,565 Y120H possibly damaging Het
Gnpat T C 8: 124,877,019 F212S probably damaging Het
Gpd1 A G 15: 99,720,607 M181V probably benign Het
Itgb3 A T 11: 104,637,088 K216N probably damaging Het
Kif21a G A 15: 90,998,005 T32M probably damaging Het
Macf1 A G 4: 123,432,584 V3477A probably damaging Het
Mettl13 A T 1: 162,546,325 L119* probably null Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh8 A G 11: 67,303,897 N1645D probably benign Het
Myo6 T C 9: 80,303,301 probably null Het
Npffr2 A T 5: 89,583,147 Y312F probably damaging Het
Pla2r1 C A 2: 60,514,968 C348F probably damaging Het
Plcb1 A G 2: 135,337,442 N590S probably damaging Het
Prpsap1 G A 11: 116,472,235 T314M probably damaging Het
Prss35 T C 9: 86,755,345 V56A probably benign Het
Setx T C 2: 29,179,898 S2572P probably benign Het
Sf3b1 T C 1: 55,016,801 D93G possibly damaging Het
Slc26a7 C A 4: 14,506,399 probably benign Het
Slc39a12 T G 2: 14,405,086 S298A probably benign Het
Sorl1 G T 9: 42,037,070 D806E probably damaging Het
Syt1 T C 10: 108,690,920 K43E possibly damaging Het
Trmt1l T A 1: 151,433,830 L88Q probably damaging Het
Zfp334 G A 2: 165,380,512 T537I probably damaging Het
Zfp574 T A 7: 25,080,057 L168* probably null Het
Other mutations in Auh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Auh APN 13 52838102 missense probably damaging 1.00
IGL02108:Auh APN 13 52889097 splice site probably benign
IGL02613:Auh APN 13 52918999 critical splice donor site probably null
PIT4131001:Auh UTSW 13 52841010 missense probably damaging 1.00
R0046:Auh UTSW 13 52929385 splice site probably benign
R0741:Auh UTSW 13 52929602 missense possibly damaging 0.53
R1480:Auh UTSW 13 52835496 missense probably benign 0.00
R1515:Auh UTSW 13 52835496 missense probably benign 0.00
R1581:Auh UTSW 13 52835496 missense probably benign 0.00
R1609:Auh UTSW 13 52835496 missense probably benign 0.00
R1611:Auh UTSW 13 52835496 missense probably benign 0.00
R1723:Auh UTSW 13 52835496 missense probably benign 0.00
R1724:Auh UTSW 13 52835496 missense probably benign 0.00
R1725:Auh UTSW 13 52835496 missense probably benign 0.00
R1742:Auh UTSW 13 52835496 missense probably benign 0.00
R1883:Auh UTSW 13 52835496 missense probably benign 0.00
R1884:Auh UTSW 13 52835496 missense probably benign 0.00
R1919:Auh UTSW 13 52835496 missense probably benign 0.00
R2022:Auh UTSW 13 52835496 missense probably benign 0.00
R2071:Auh UTSW 13 52835496 missense probably benign 0.00
R2114:Auh UTSW 13 52835496 missense probably benign 0.00
R2147:Auh UTSW 13 52835496 missense probably benign 0.00
R2149:Auh UTSW 13 52835496 missense probably benign 0.00
R2508:Auh UTSW 13 52898719 nonsense probably null
R2960:Auh UTSW 13 52839574 missense probably damaging 1.00
R3787:Auh UTSW 13 52929457 missense possibly damaging 0.95
R4594:Auh UTSW 13 52912966 unclassified probably benign
R4989:Auh UTSW 13 52841029 missense probably damaging 1.00
R5863:Auh UTSW 13 52898658 missense probably benign 0.06
R6041:Auh UTSW 13 52919086 missense possibly damaging 0.71
R6425:Auh UTSW 13 52841044 missense probably damaging 1.00
R6430:Auh UTSW 13 52929410 missense probably benign 0.41
R6434:Auh UTSW 13 52929410 missense probably benign 0.41
R6664:Auh UTSW 13 52898667 missense probably damaging 0.99
R6865:Auh UTSW 13 52838129 missense probably damaging 1.00
R7615:Auh UTSW 13 52919013 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCAGCTTCCATCAAATGCCTG -3'
(R):5'- TGGTGAGTGGAAGACTACGC -3'

Sequencing Primer
(F):5'- AAGCGATACAGTCATCCCTG -3'
(R):5'- GAAGACTACGCTGTTTGCTTC -3'
Posted On2014-11-12