Incidental Mutation 'R2429:Batf2'
ID250359
Institutional Source Beutler Lab
Gene Symbol Batf2
Ensembl Gene ENSMUSG00000039699
Gene Namebasic leucine zipper transcription factor, ATF-like 2
Synonyms
MMRRC Submission 040391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R2429 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6140983-6172476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6171508 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 116 (Y116C)
Ref Sequence ENSEMBL: ENSMUSP00000045744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045042]
Predicted Effect probably damaging
Transcript: ENSMUST00000045042
AA Change: Y116C

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045744
Gene: ENSMUSG00000039699
AA Change: Y116C

DomainStartEndE-ValueType
BRLZ 16 80 6.76e-12 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 168 195 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141858
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to parasitic infection induced morbidity/mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik A T 2: 170,579,825 M45K unknown Het
Abcd3 A G 3: 121,792,863 F63L probably damaging Het
Acsm3 A T 7: 119,768,000 M19L probably benign Het
Actn4 T C 7: 28,898,071 K41E probably benign Het
Atp8b3 T A 10: 80,526,894 I677L probably benign Het
Auh C T 13: 52,919,016 G110R probably damaging Het
Cntn6 T C 6: 104,650,565 Y120H possibly damaging Het
Gnpat T C 8: 124,877,019 F212S probably damaging Het
Gpd1 A G 15: 99,720,607 M181V probably benign Het
Itgb3 A T 11: 104,637,088 K216N probably damaging Het
Kif21a G A 15: 90,998,005 T32M probably damaging Het
Macf1 A G 4: 123,432,584 V3477A probably damaging Het
Mettl13 A T 1: 162,546,325 L119* probably null Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh8 A G 11: 67,303,897 N1645D probably benign Het
Myo6 T C 9: 80,303,301 probably null Het
Npffr2 A T 5: 89,583,147 Y312F probably damaging Het
Pla2r1 C A 2: 60,514,968 C348F probably damaging Het
Plcb1 A G 2: 135,337,442 N590S probably damaging Het
Prpsap1 G A 11: 116,472,235 T314M probably damaging Het
Prss35 T C 9: 86,755,345 V56A probably benign Het
Setx T C 2: 29,179,898 S2572P probably benign Het
Sf3b1 T C 1: 55,016,801 D93G possibly damaging Het
Slc26a7 C A 4: 14,506,399 probably benign Het
Slc39a12 T G 2: 14,405,086 S298A probably benign Het
Sorl1 G T 9: 42,037,070 D806E probably damaging Het
Syt1 T C 10: 108,690,920 K43E possibly damaging Het
Trmt1l T A 1: 151,433,830 L88Q probably damaging Het
Zfp334 G A 2: 165,380,512 T537I probably damaging Het
Zfp574 T A 7: 25,080,057 L168* probably null Het
Other mutations in Batf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02212:Batf2 APN 19 6171961 missense probably damaging 1.00
IGL02552:Batf2 APN 19 6171507 missense probably benign 0.43
IGL02966:Batf2 APN 19 6171789 missense probably damaging 0.96
R4008:Batf2 UTSW 19 6171348 missense probably damaging 1.00
R4712:Batf2 UTSW 19 6171327 missense probably benign 0.24
R7082:Batf2 UTSW 19 6171375 missense possibly damaging 0.78
R7267:Batf2 UTSW 19 6171366 missense probably benign
R7400:Batf2 UTSW 19 6171508 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCTTGGAGAAACAGAACCACG -3'
(R):5'- CTTAGAGAAAGACCCCAGCAGG -3'

Sequencing Primer
(F):5'- GAACCACGCCCTTCGGAAG -3'
(R):5'- CAGCAGGCTGGAACCAG -3'
Posted On2014-11-12