Incidental Mutation 'R0309:Unc5c'
Institutional Source Beutler Lab
Gene Symbol Unc5c
Ensembl Gene ENSMUSG00000059921
Gene Nameunc-5 netrin receptor C
SynonymsB130051O18Rik, Unc5h3
MMRRC Submission 038519-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0309 (G1)
Quality Score225
Status Validated
Chromosomal Location141465216-141834924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 141733933 bp
Amino Acid Change Valine to Leucine at position 196 (V196L)
Ref Sequence ENSEMBL: ENSMUSP00000118212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075282] [ENSMUST00000106236] [ENSMUST00000130636] [ENSMUST00000142762]
Predicted Effect probably benign
Transcript: ENSMUST00000075282
AA Change: V196L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000074758
Gene: ENSMUSG00000059921
AA Change: V196L

signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106236
AA Change: V196L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101843
Gene: ENSMUSG00000059921
AA Change: V196L

signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 377 399 N/A INTRINSIC
ZU5 528 631 6.92e-63 SMART
low complexity region 676 685 N/A INTRINSIC
DEATH 838 929 6.68e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130636
AA Change: V122L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000117487
Gene: ENSMUSG00000059921
AA Change: V122L

signal peptide 1 39 N/A INTRINSIC
IGc2 105 172 2.72e-5 SMART
TSP1 189 240 8.54e-13 SMART
TSP1 245 294 1.18e-6 SMART
transmembrane domain 322 344 N/A INTRINSIC
ZU5 473 576 6.92e-63 SMART
low complexity region 621 630 N/A INTRINSIC
DEATH 783 874 6.68e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142762
AA Change: V196L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000118212
Gene: ENSMUSG00000059921
AA Change: V196L

signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Meta Mutation Damage Score 0.0635 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.6%
  • 10x: 94.3%
  • 20x: 86.4%
Validation Efficiency 98% (125/127)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the UNC-5 family of netrin receptors. Netrins are secreted proteins that direct axon extension and cell migration during neural development. They are bifunctional proteins that act as attractants for some cell types and as repellents for others, and these opposite actions are thought to be mediated by two classes of receptors. The UNC-5 family of receptors mediate the repellent response to netrin; they are transmembrane proteins containing 2 immunoglobulin (Ig)-like domains and 2 type I thrombospondin motifs in the extracellular region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants exhibit ataxia, and reduced size early in life. Mutants exhibit cerebellar defects including reduced size and ectopic cerebellar cells in the midbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T C 2: 35,376,259 D133G possibly damaging Het
Abcb4 A C 5: 8,939,835 D796A probably damaging Het
Actg2 A T 6: 83,519,914 V147E probably damaging Het
Adamts13 A C 2: 26,986,989 T534P probably damaging Het
Ago1 T C 4: 126,443,166 T249A probably benign Het
Ahnak T A 19: 9,002,495 I381N probably damaging Het
Akap9 A G 5: 4,069,038 D3515G probably benign Het
Angptl3 T C 4: 99,034,469 V249A probably benign Het
Ank A G 15: 27,567,572 T294A possibly damaging Het
Ank1 A T 8: 23,104,809 H204L probably damaging Het
Apbb2 A G 5: 66,310,988 probably benign Het
Arhgap28 A T 17: 67,901,429 S15T probably benign Het
Aspm T C 1: 139,482,511 probably benign Het
Atp1a4 T C 1: 172,234,987 E651G probably damaging Het
B3gnt2 A T 11: 22,836,860 F109L probably damaging Het
Bpifb4 T C 2: 153,959,683 F575L probably damaging Het
Calr C A 8: 84,843,031 K322N probably benign Het
Ccdc188 T C 16: 18,219,305 S247P possibly damaging Het
Cdr1 T A X: 61,185,302 D86V unknown Het
Cep97 C T 16: 55,925,058 V48I probably damaging Het
Chaf1b T A 16: 93,884,511 C6S probably damaging Het
Chd3 C T 11: 69,357,018 D920N probably damaging Het
Clk1 T C 1: 58,413,033 probably benign Het
Cntnap3 T A 13: 64,757,436 probably benign Het
Col12a1 T A 9: 79,600,011 probably null Het
Col17a1 G T 19: 47,671,362 probably benign Het
Coq7 T A 7: 118,529,717 I32F possibly damaging Het
Cox6a2 A T 7: 128,205,935 F59I probably damaging Het
Cpq A G 15: 33,594,151 D436G probably damaging Het
Ctso G A 3: 81,944,861 probably null Het
Cxadr A T 16: 78,334,948 H274L probably benign Het
Cyp2c40 A T 19: 39,778,051 C367S possibly damaging Het
Cyp2c70 T G 19: 40,160,671 M344L possibly damaging Het
Defa35 G A 8: 21,065,855 V77I probably benign Het
Dhx57 A G 17: 80,274,881 Y432H probably damaging Het
Dhx9 A T 1: 153,465,695 D601E probably benign Het
Dnah7a C G 1: 53,405,690 D3952H probably damaging Het
Dnah9 C A 11: 66,026,972 probably benign Het
Dstyk C A 1: 132,456,864 probably benign Het
Efcab2 T A 1: 178,475,904 probably benign Het
Ehbp1l1 T C 19: 5,720,570 E287G possibly damaging Het
Epgn A G 5: 91,032,214 T87A probably benign Het
Erc2 A C 14: 28,141,225 E803A probably damaging Het
Fam26d A G 10: 34,044,047 W75R probably damaging Het
Fer A G 17: 64,139,016 *454W probably null Het
Glyr1 T C 16: 5,031,972 D179G probably damaging Het
Gm12830 T A 4: 114,844,976 probably benign Het
Gm14085 A T 2: 122,517,553 T253S probably benign Het
Gm9922 C A 14: 101,729,693 probably benign Het
Gsta3 C T 1: 21,264,894 P200S possibly damaging Het
Hmgxb3 G A 18: 61,155,128 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il16 T C 7: 83,722,554 K15E probably damaging Het
Kcnip2 T A 19: 45,794,075 probably benign Het
Kdm4c T C 4: 74,345,567 V696A probably benign Het
Kdr A G 5: 75,946,927 probably benign Het
Klhl33 T G 14: 50,891,411 H787P probably damaging Het
Klk14 A T 7: 43,694,345 T159S probably benign Het
Lancl2 A G 6: 57,703,132 N16D probably damaging Het
Lemd3 T C 10: 120,937,110 N583S possibly damaging Het
Map3k4 TGCTGGCTTCAGGGCCACAGTCCGCTG TGCTG 17: 12,271,015 probably null Het
Mpl T G 4: 118,446,038 probably benign Het
Myh7b T C 2: 155,630,672 probably benign Het
Mylk A C 16: 34,912,297 probably benign Het
Myof A T 19: 37,981,266 M316K probably benign Het
Nfib T A 4: 82,296,737 N543I probably damaging Het
Nfix A G 8: 84,721,774 S375P probably damaging Het
Nkrf T C X: 36,890,116 Q171R probably damaging Het
Nmnat2 T A 1: 153,077,001 probably benign Het
Npffr2 G A 5: 89,583,347 E379K probably benign Het
Npr2 T C 4: 43,640,904 probably benign Het
Nup98 A C 7: 102,152,428 D212E probably null Het
Nwd2 T C 5: 63,807,218 Y1382H probably damaging Het
Ocstamp T C 2: 165,395,992 R451G possibly damaging Het
Olfr593 T A 7: 103,212,721 I287K probably damaging Het
Olfr804 A G 10: 129,705,139 D87G probably benign Het
Pabpc1 C T 15: 36,597,493 A551T possibly damaging Het
Papd7 A T 13: 69,499,932 V781E possibly damaging Het
Pard3 A T 8: 127,376,897 probably benign Het
Pcdhb12 G T 18: 37,436,121 V107L probably benign Het
Pik3cd A T 4: 149,663,220 V22D probably damaging Het
Pkd1l2 A G 8: 116,997,576 V2396A probably damaging Het
Pnpla7 T C 2: 24,987,195 I167T probably damaging Het
Pphln1 A T 15: 93,441,707 H114L possibly damaging Het
Ppm1h A G 10: 122,920,782 N444S probably damaging Het
Prdm9 G A 17: 15,557,384 T146I probably damaging Het
Prrc2a A G 17: 35,150,915 probably benign Het
Prrx1 T C 1: 163,312,559 D26G possibly damaging Het
Ptpn5 T C 7: 47,079,294 E495G probably damaging Het
Rab23 A C 1: 33,734,861 probably null Het
Ralgps1 C T 2: 33,157,923 M348I probably benign Het
Ranbp2 A G 10: 58,479,868 T2137A probably benign Het
Rapgef4 G T 2: 72,226,030 G654V probably benign Het
Rc3h2 A T 2: 37,379,008 probably benign Het
Reg2 G A 6: 78,406,186 A39T possibly damaging Het
Sema4d C A 13: 51,725,311 V7F probably benign Het
Sgip1 T C 4: 102,915,157 probably benign Het
Sgpl1 C T 10: 61,113,437 probably null Het
Shisa9 G A 16: 11,997,123 V212M probably damaging Het
Shq1 G A 6: 100,573,627 P450L probably benign Het
Sin3a A G 9: 57,110,912 T872A probably benign Het
Sipa1l3 C T 7: 29,348,350 R1371Q probably benign Het
Skint8 T C 4: 111,938,867 V246A probably benign Het
Slc22a20 A T 19: 5,972,957 V386D probably damaging Het
Slc2a7 G A 4: 150,158,071 probably benign Het
Slc35a2 T A X: 7,889,662 Y48N probably damaging Het
Slc4a2 G T 5: 24,434,346 S413I probably damaging Het
Sntg2 T C 12: 30,226,773 T427A probably benign Het
Soat1 T C 1: 156,442,453 Y132C probably damaging Het
Stn1 G T 19: 47,501,673 H342N probably benign Het
Tarbp1 T A 8: 126,438,928 probably benign Het
Tas2r113 A C 6: 132,893,378 K123T probably damaging Het
Tbck C T 3: 132,734,407 Q504* probably null Het
Tenm3 C T 8: 48,341,034 C380Y probably damaging Het
Triobp A G 15: 78,976,540 D1389G probably damaging Het
Trpm4 A T 7: 45,308,706 F780I probably damaging Het
Tubb4a G T 17: 57,081,182 Y281* probably null Het
Txndc15 T C 13: 55,724,582 F261S probably damaging Het
Ube3b T C 5: 114,419,469 probably benign Het
Upf3a G A 8: 13,795,500 probably null Het
Vmn2r20 T C 6: 123,386,104 K574E probably benign Het
Vps50 A G 6: 3,536,853 M275V possibly damaging Het
Xrcc5 A G 1: 72,307,576 probably benign Het
Zbtb18 T C 1: 177,448,616 L505S probably damaging Het
Zbtb41 T C 1: 139,438,984 I567T probably damaging Het
Zfp598 T C 17: 24,678,584 probably benign Het
Other mutations in Unc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Unc5c APN 3 141788940 missense probably damaging 0.99
IGL01089:Unc5c APN 3 141818202 splice site probably benign
IGL01478:Unc5c APN 3 141828451 missense probably damaging 1.00
IGL02083:Unc5c APN 3 141714647 missense probably damaging 0.99
IGL02269:Unc5c APN 3 141788982 missense probably damaging 1.00
IGL02565:Unc5c APN 3 141803919 missense probably damaging 1.00
IGL02973:Unc5c APN 3 141788890 missense probably benign 0.12
R0179:Unc5c UTSW 3 141818067 nonsense probably null
R0371:Unc5c UTSW 3 141827522 missense probably benign 0.01
R0603:Unc5c UTSW 3 141771102 missense probably damaging 1.00
R0904:Unc5c UTSW 3 141803840 missense probably benign 0.08
R0907:Unc5c UTSW 3 141789033 missense probably damaging 0.99
R1300:Unc5c UTSW 3 141828543 missense possibly damaging 0.94
R1491:Unc5c UTSW 3 141789822 missense probably damaging 1.00
R1494:Unc5c UTSW 3 141827549 missense possibly damaging 0.93
R1674:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1676:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1726:Unc5c UTSW 3 141818103 missense probably damaging 1.00
R1750:Unc5c UTSW 3 141827517 missense possibly damaging 0.89
R1815:Unc5c UTSW 3 141757757 missense probably damaging 1.00
R2381:Unc5c UTSW 3 141678155 missense probably damaging 1.00
R2394:Unc5c UTSW 3 141678131 missense probably damaging 1.00
R2945:Unc5c UTSW 3 141789974 missense probably damaging 0.97
R4284:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4285:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4287:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4681:Unc5c UTSW 3 141768613 critical splice donor site probably null
R4736:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4740:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4774:Unc5c UTSW 3 141828517 missense probably damaging 1.00
R4862:Unc5c UTSW 3 141789773 missense probably damaging 1.00
R4905:Unc5c UTSW 3 141801310 missense probably benign 0.19
R4921:Unc5c UTSW 3 141788966 missense probably damaging 1.00
R5150:Unc5c UTSW 3 141757793 missense probably damaging 1.00
R5559:Unc5c UTSW 3 141803787 missense probably damaging 1.00
R5562:Unc5c UTSW 3 141768530 missense probably damaging 1.00
R5643:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5644:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5775:Unc5c UTSW 3 141828520 missense probably damaging 1.00
R5912:Unc5c UTSW 3 141789006 missense probably damaging 1.00
R6154:Unc5c UTSW 3 141678153 missense probably damaging 0.97
R6547:Unc5c UTSW 3 141790019 missense probably benign 0.16
R6558:Unc5c UTSW 3 141789729 missense probably damaging 0.98
R7104:Unc5c UTSW 3 141733904 missense probably damaging 1.00
R7113:Unc5c UTSW 3 141801293 missense probably benign 0.00
R7282:Unc5c UTSW 3 141677990 missense probably damaging 0.98
R7317:Unc5c UTSW 3 141789942 missense probably benign 0.00
R7787:Unc5c UTSW 3 141768552 missense probably damaging 1.00
R7873:Unc5c UTSW 3 141827549 missense probably benign 0.04
R7896:Unc5c UTSW 3 141771161 missense possibly damaging 0.73
R7956:Unc5c UTSW 3 141827549 missense probably benign 0.04
R7979:Unc5c UTSW 3 141771161 missense possibly damaging 0.73
X0018:Unc5c UTSW 3 141714739 missense probably damaging 1.00
X0065:Unc5c UTSW 3 141827661 missense probably damaging 1.00
Z1088:Unc5c UTSW 3 141733900 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2013-04-16