Mutagenetix > Incidental Mutation

Incidental Mutation 'R2430:Ppip5k2'

250360

Institutional Source

Beutler Lab

Gene Symbol

Ppip5k2

Ensembl Gene

ENSMUSG00000040648

Gene Name

diphosphoinositol pentakisphosphate kinase 2

Synonyms

Hisppd1, Cfap160, Vip2

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.231) question?

Stock #

R2430 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

97633773-97698136 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 97662755 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 667 (Y667N)

Ref Sequence

ENSEMBL: ENSMUSP00000108466 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042509] [ENSMUST00000112845] [ENSMUST00000171129]

AlphaFold

Q6ZQB6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042509
AA Change: Y673N

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000043401
Gene: ENSMUSG00000040648
AA Change: Y673N

Domain	Start	End	E-Value	Type
low complexity region	29	41	N/A	INTRINSIC
PDB:4NZO\|A	42	366	N/A	PDB
Pfam:His_Phos_2	379	894	2.9e-112	PFAM
low complexity region	1073	1092	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112845
AA Change: Y667N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108466
Gene: ENSMUSG00000040648
AA Change: Y667N

Domain	Start	End	E-Value	Type
low complexity region	29	41	N/A	INTRINSIC
PDB:4NZO\|A	42	366	N/A	PDB
Pfam:His_Phos_2	379	894	6.9e-141	PFAM
low complexity region	993	1006	N/A	INTRINSIC
low complexity region	1192	1211	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171129
AA Change: Y667N

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000132889
Gene: ENSMUSG00000040648
AA Change: Y667N

Domain	Start	End	E-Value	Type
low complexity region	29	41	N/A	INTRINSIC
PDB:4NZO\|A	42	366	N/A	PDB
Pfam:His_Phos_2	379	894	2.9e-112	PFAM
low complexity region	1073	1092	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the histidine acid phosphatase family of proteins. Despite containing a histidine acid phosphatase domain, the encoded protein functions as an inositol pyrophosphate kinase, and is thought to lack phosphatase activity. This kinase activity is the mechanism by which the encoded protein synthesizes high-energy inositol pyrophosphates, which act as signaling molecules that regulate cellular homeostasis and other processes. This gene may be associated with autism spectrum disorder in human patients. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arc	T	C	15: 74,543,740 (GRCm39)	E161G	probably benign	Het
Ass1	A	G	2: 31,391,508 (GRCm39)	H261R	probably damaging	Het
Car11	T	A	7: 45,353,072 (GRCm39)		probably null	Het
Crebbp	T	C	16: 3,914,329 (GRCm39)	H844R	probably damaging	Het
Dnai2	A	G	11: 114,648,012 (GRCm39)		probably benign	Het
Eya2	T	C	2: 165,558,050 (GRCm39)		probably null	Het
Klhl40	A	G	9: 121,609,667 (GRCm39)	D484G	possibly damaging	Het
Knstrn	A	G	2: 118,664,584 (GRCm39)		probably benign	Het
Nckap5	A	G	1: 125,842,494 (GRCm39)	S1838P	probably damaging	Het
Nipsnap2	A	G	5: 129,821,855 (GRCm39)	D117G	possibly damaging	Het
Nudt15	C	T	14: 73,762,742 (GRCm39)		probably benign	Het
Or5w16	T	A	2: 87,576,999 (GRCm39)	M153K	possibly damaging	Het
Or8k35	A	G	2: 86,425,052 (GRCm39)	I40T	probably benign	Het
Pcdh20	T	C	14: 88,704,984 (GRCm39)	D772G	probably damaging	Het
Pdss1	T	A	2: 22,819,605 (GRCm39)	Y289*	probably null	Het
Phc2	A	T	4: 128,601,776 (GRCm39)	Y77F	probably damaging	Het
Prdm2	A	G	4: 142,859,733 (GRCm39)	S1186P	possibly damaging	Het
Prr36	A	T	8: 4,263,488 (GRCm39)		probably benign	Het
Reck	C	T	4: 43,930,202 (GRCm39)	T592I	possibly damaging	Het
Rprd2	T	A	3: 95,672,107 (GRCm39)	K1015*	probably null	Het
Tfrc	T	G	16: 32,445,529 (GRCm39)	Y617D	probably damaging	Het
Tnfsf11	A	C	14: 78,521,752 (GRCm39)	D152E	probably benign	Het
Vmn2r54	T	A	7: 12,365,933 (GRCm39)	I334F	probably damaging	Het

Other mutations in Ppip5k2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01927:Ppip5k2	APN	1	97,640,848 (GRCm39)	missense	probably damaging	1.00
IGL02266:Ppip5k2	APN	1	97,661,697 (GRCm39)	missense	possibly damaging	0.68
IGL02705:Ppip5k2	APN	1	97,686,924 (GRCm39)	missense	probably damaging	1.00
IGL03229:Ppip5k2	APN	1	97,656,686 (GRCm39)	missense	probably damaging	1.00
P0033:Ppip5k2	UTSW	1	97,645,253 (GRCm39)	missense	probably damaging	0.98
R0082:Ppip5k2	UTSW	1	97,687,057 (GRCm39)	nonsense	probably null
R0242:Ppip5k2	UTSW	1	97,668,816 (GRCm39)	missense	probably damaging	1.00
R0242:Ppip5k2	UTSW	1	97,668,816 (GRCm39)	missense	probably damaging	1.00
R0267:Ppip5k2	UTSW	1	97,656,722 (GRCm39)	missense	probably damaging	1.00
R0281:Ppip5k2	UTSW	1	97,644,278 (GRCm39)	missense	possibly damaging	0.95
R0373:Ppip5k2	UTSW	1	97,668,262 (GRCm39)	nonsense	probably null
R0402:Ppip5k2	UTSW	1	97,647,579 (GRCm39)	missense	probably benign	0.00
R0423:Ppip5k2	UTSW	1	97,689,152 (GRCm39)	missense	possibly damaging	0.95
R0613:Ppip5k2	UTSW	1	97,680,465 (GRCm39)	nonsense	probably null
R0751:Ppip5k2	UTSW	1	97,677,377 (GRCm39)	nonsense	probably null
R1121:Ppip5k2	UTSW	1	97,684,585 (GRCm39)	missense	probably damaging	1.00
R1265:Ppip5k2	UTSW	1	97,647,625 (GRCm39)	missense	probably benign	0.00
R1436:Ppip5k2	UTSW	1	97,639,507 (GRCm39)	missense	probably benign	0.04
R1543:Ppip5k2	UTSW	1	97,668,607 (GRCm39)	missense	probably damaging	1.00
R1739:Ppip5k2	UTSW	1	97,656,682 (GRCm39)	missense	probably damaging	1.00
R1845:Ppip5k2	UTSW	1	97,651,531 (GRCm39)	missense	possibly damaging	0.74
R2191:Ppip5k2	UTSW	1	97,671,835 (GRCm39)	missense	probably damaging	0.99
R2762:Ppip5k2	UTSW	1	97,645,234 (GRCm39)	missense	probably damaging	1.00
R3014:Ppip5k2	UTSW	1	97,671,800 (GRCm39)	missense	probably damaging	0.99
R3759:Ppip5k2	UTSW	1	97,683,610 (GRCm39)	critical splice donor site	probably null
R4603:Ppip5k2	UTSW	1	97,682,861 (GRCm39)	missense	probably damaging	1.00
R4772:Ppip5k2	UTSW	1	97,648,792 (GRCm39)	unclassified	probably benign
R4951:Ppip5k2	UTSW	1	97,639,474 (GRCm39)	missense	possibly damaging	0.77
R5348:Ppip5k2	UTSW	1	97,675,317 (GRCm39)	missense	possibly damaging	0.94
R5350:Ppip5k2	UTSW	1	97,648,853 (GRCm39)	missense	probably damaging	0.98
R5584:Ppip5k2	UTSW	1	97,678,366 (GRCm39)	missense	probably damaging	1.00
R5599:Ppip5k2	UTSW	1	97,668,323 (GRCm39)	missense	probably damaging	1.00
R5883:Ppip5k2	UTSW	1	97,635,535 (GRCm39)	missense	possibly damaging	0.53
R5898:Ppip5k2	UTSW	1	97,671,887 (GRCm39)	intron	probably benign
R6184:Ppip5k2	UTSW	1	97,661,730 (GRCm39)	missense	possibly damaging	0.89
R6221:Ppip5k2	UTSW	1	97,657,753 (GRCm39)	missense	probably damaging	1.00
R6775:Ppip5k2	UTSW	1	97,647,585 (GRCm39)	missense	possibly damaging	0.49
R7250:Ppip5k2	UTSW	1	97,673,187 (GRCm39)	missense	probably benign	0.00
R7329:Ppip5k2	UTSW	1	97,678,478 (GRCm39)	splice site	probably null
R7357:Ppip5k2	UTSW	1	97,686,941 (GRCm39)	missense	possibly damaging	0.91
R7852:Ppip5k2	UTSW	1	97,668,896 (GRCm39)	missense	probably damaging	0.99
R7884:Ppip5k2	UTSW	1	97,668,207 (GRCm39)	missense	probably benign	0.00
R8006:Ppip5k2	UTSW	1	97,661,831 (GRCm39)	missense	probably benign	0.00
R8134:Ppip5k2	UTSW	1	97,672,888 (GRCm39)	missense	probably benign	0.12
R8274:Ppip5k2	UTSW	1	97,686,941 (GRCm39)	missense	possibly damaging	0.91
R8436:Ppip5k2	UTSW	1	97,683,613 (GRCm39)	missense	probably benign
R8440:Ppip5k2	UTSW	1	97,675,276 (GRCm39)	missense	probably damaging	0.99
R8895:Ppip5k2	UTSW	1	97,639,544 (GRCm39)	missense	probably benign
R9017:Ppip5k2	UTSW	1	97,655,139 (GRCm39)	missense	probably damaging	1.00
R9061:Ppip5k2	UTSW	1	97,645,187 (GRCm39)	missense	probably damaging	1.00
R9441:Ppip5k2	UTSW	1	97,672,921 (GRCm39)	missense	probably benign	0.00
R9533:Ppip5k2	UTSW	1	97,661,792 (GRCm39)	missense	probably benign	0.11
R9715:Ppip5k2	UTSW	1	97,677,312 (GRCm39)	missense
R9792:Ppip5k2	UTSW	1	97,671,822 (GRCm39)	nonsense	probably null
R9793:Ppip5k2	UTSW	1	97,671,822 (GRCm39)	nonsense	probably null
R9795:Ppip5k2	UTSW	1	97,671,822 (GRCm39)	nonsense	probably null
Z1177:Ppip5k2	UTSW	1	97,644,330 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGATGAAGTAAGATGCTGCTGTC -3'
(R):5'- ACTTTCACATCCCTGTTGATGG -3'

Sequencing Primer
(F):5'- AAGATGCTGCTGTCTTTTTCTTACAG -3'
(R):5'- CACATCCCTGTTGATGGTATTATG -3'

Posted On

2014-11-12