Incidental Mutation 'R2430:Pdss1'
ID 250362
Institutional Source Beutler Lab
Gene Symbol Pdss1
Ensembl Gene ENSMUSG00000026784
Gene Name prenyl (solanesyl) diphosphate synthase, subunit 1
Synonyms 2610203G20Rik, mSPS1, 2700031G06Rik, Tprt
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2430 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 22785534-22830278 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 22819605 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 289 (Y289*)
Ref Sequence ENSEMBL: ENSMUSP00000055689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053729]
AlphaFold Q33DR2
Predicted Effect probably null
Transcript: ENSMUST00000053729
AA Change: Y289*
SMART Domains Protein: ENSMUSP00000055689
Gene: ENSMUSG00000026784
AA Change: Y289*

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:polyprenyl_synt 117 366 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139472
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that elongates the prenyl side-chain of coenzyme Q, or ubiquinone, one of the key elements in the respiratory chain. The gene product catalyzes the formation of all trans-polyprenyl pyrophosphates from isopentyl diphosphate in the assembly of polyisoprenoid side chains, the first step in coenzyme Q biosynthesis. The protein may be peripherally associated with the inner mitochondrial membrane, though no transit peptide has been definitively identified to date. Defects in this gene are a cause of coenzyme Q10 deficiency. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc T C 15: 74,543,740 (GRCm39) E161G probably benign Het
Ass1 A G 2: 31,391,508 (GRCm39) H261R probably damaging Het
Car11 T A 7: 45,353,072 (GRCm39) probably null Het
Crebbp T C 16: 3,914,329 (GRCm39) H844R probably damaging Het
Dnai2 A G 11: 114,648,012 (GRCm39) probably benign Het
Eya2 T C 2: 165,558,050 (GRCm39) probably null Het
Klhl40 A G 9: 121,609,667 (GRCm39) D484G possibly damaging Het
Knstrn A G 2: 118,664,584 (GRCm39) probably benign Het
Nckap5 A G 1: 125,842,494 (GRCm39) S1838P probably damaging Het
Nipsnap2 A G 5: 129,821,855 (GRCm39) D117G possibly damaging Het
Nudt15 C T 14: 73,762,742 (GRCm39) probably benign Het
Or5w16 T A 2: 87,576,999 (GRCm39) M153K possibly damaging Het
Or8k35 A G 2: 86,425,052 (GRCm39) I40T probably benign Het
Pcdh20 T C 14: 88,704,984 (GRCm39) D772G probably damaging Het
Phc2 A T 4: 128,601,776 (GRCm39) Y77F probably damaging Het
Ppip5k2 A T 1: 97,662,755 (GRCm39) Y667N probably damaging Het
Prdm2 A G 4: 142,859,733 (GRCm39) S1186P possibly damaging Het
Prr36 A T 8: 4,263,488 (GRCm39) probably benign Het
Reck C T 4: 43,930,202 (GRCm39) T592I possibly damaging Het
Rprd2 T A 3: 95,672,107 (GRCm39) K1015* probably null Het
Tfrc T G 16: 32,445,529 (GRCm39) Y617D probably damaging Het
Tnfsf11 A C 14: 78,521,752 (GRCm39) D152E probably benign Het
Vmn2r54 T A 7: 12,365,933 (GRCm39) I334F probably damaging Het
Other mutations in Pdss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Pdss1 APN 2 22,825,589 (GRCm39) missense possibly damaging 0.49
IGL02512:Pdss1 APN 2 22,802,658 (GRCm39) missense probably damaging 1.00
IGL02691:Pdss1 APN 2 22,805,253 (GRCm39) missense probably benign
LCD18:Pdss1 UTSW 2 22,790,980 (GRCm39) intron probably benign
R0190:Pdss1 UTSW 2 22,796,843 (GRCm39) missense probably damaging 0.97
R0576:Pdss1 UTSW 2 22,805,425 (GRCm39) critical splice acceptor site probably null
R0732:Pdss1 UTSW 2 22,791,324 (GRCm39) missense probably benign 0.00
R1682:Pdss1 UTSW 2 22,805,531 (GRCm39) missense probably damaging 1.00
R1808:Pdss1 UTSW 2 22,796,846 (GRCm39) nonsense probably null
R2937:Pdss1 UTSW 2 22,796,799 (GRCm39) splice site probably null
R2938:Pdss1 UTSW 2 22,796,799 (GRCm39) splice site probably null
R4181:Pdss1 UTSW 2 22,805,517 (GRCm39) missense probably damaging 1.00
R4302:Pdss1 UTSW 2 22,805,517 (GRCm39) missense probably damaging 1.00
R4323:Pdss1 UTSW 2 22,802,608 (GRCm39) splice site probably benign
R5076:Pdss1 UTSW 2 22,789,929 (GRCm39) critical splice acceptor site probably null
R5108:Pdss1 UTSW 2 22,796,895 (GRCm39) missense possibly damaging 0.94
R6333:Pdss1 UTSW 2 22,791,778 (GRCm39) missense probably damaging 1.00
R7138:Pdss1 UTSW 2 22,802,681 (GRCm39) missense probably damaging 1.00
R7286:Pdss1 UTSW 2 22,825,653 (GRCm39) critical splice donor site probably null
R8169:Pdss1 UTSW 2 22,791,824 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGTGCCAGCATCCCCATTG -3'
(R):5'- GCTATGCCTAGCTTCAGGTC -3'

Sequencing Primer
(F):5'- AGCATCCCCATTGTCTATAGCATAGG -3'
(R):5'- TTGCCCATCTGGTCAGAACATGAG -3'
Posted On 2014-11-12