Incidental Mutation 'R2430:Olfr1082'
ID250364
Institutional Source Beutler Lab
Gene Symbol Olfr1082
Ensembl Gene ENSMUSG00000111689
Gene Nameolfactory receptor 1082
SynonymsGA_x6K02T2Q125-48079993-48079157, MOR192-4_p
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R2430 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86593412-86598966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86594708 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 40 (I40T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000215600]
Predicted Effect probably benign
Transcript: ENSMUST00000111578
AA Change: I40T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107204
Gene: ENSMUSG00000079239
AA Change: I40T

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 5.6e-31 PFAM
Pfam:7tm_4 139 283 4.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111579
AA Change: I40T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107205
Gene: ENSMUSG00000079239
AA Change: I40T

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.2e-48 PFAM
Pfam:7tm_1 41 290 1.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215600
AA Change: I40T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc T C 15: 74,671,891 E161G probably benign Het
Ass1 A G 2: 31,501,496 H261R probably damaging Het
Car11 T A 7: 45,703,648 probably null Het
Crebbp T C 16: 4,096,465 H844R probably damaging Het
Dnaic2 A G 11: 114,757,186 probably benign Het
Eya2 T C 2: 165,716,130 probably null Het
Klhl40 A G 9: 121,780,601 D484G possibly damaging Het
Knstrn A G 2: 118,834,103 probably benign Het
Nckap5 A G 1: 125,914,757 S1838P probably damaging Het
Nipsnap2 A G 5: 129,744,791 D117G possibly damaging Het
Nudt15 C T 14: 73,525,302 probably benign Het
Olfr1140 T A 2: 87,746,655 M153K possibly damaging Het
Pcdh20 T C 14: 88,467,548 D772G probably damaging Het
Pdss1 T A 2: 22,929,593 Y289* probably null Het
Phc2 A T 4: 128,707,983 Y77F probably damaging Het
Ppip5k2 A T 1: 97,735,030 Y667N probably damaging Het
Prdm2 A G 4: 143,133,163 S1186P possibly damaging Het
Prr36 A T 8: 4,213,488 probably benign Het
Reck C T 4: 43,930,202 T592I possibly damaging Het
Rprd2 T A 3: 95,764,795 K1015* probably null Het
Tfrc T G 16: 32,626,711 Y617D probably damaging Het
Tnfsf11 A C 14: 78,284,312 D152E probably benign Het
Vmn2r54 T A 7: 12,632,006 I334F probably damaging Het
Other mutations in Olfr1082
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0483:Olfr1082 UTSW 2 86594408 missense probably benign 0.07
R0675:Olfr1082 UTSW 2 86594079 missense probably benign 0.00
R0718:Olfr1082 UTSW 2 86594081 missense probably benign 0.01
R0727:Olfr1082 UTSW 2 86594380 nonsense probably null
R1517:Olfr1082 UTSW 2 86594604 missense probably damaging 0.99
R1850:Olfr1082 UTSW 2 86594104 nonsense probably null
R2474:Olfr1082 UTSW 2 86594613 missense probably benign 0.00
R3009:Olfr1082 UTSW 2 86594370 missense probably benign 0.07
R3122:Olfr1082 UTSW 2 86594610 missense possibly damaging 0.91
R4006:Olfr1082 UTSW 2 86594564 missense probably benign 0.14
R4007:Olfr1082 UTSW 2 86594564 missense probably benign 0.14
R4581:Olfr1082 UTSW 2 86594228 missense probably benign 0.08
R4762:Olfr1082 UTSW 2 86594037 missense possibly damaging 0.60
R5617:Olfr1082 UTSW 2 86594001 missense probably benign 0.07
R6118:Olfr1082 UTSW 2 86594414 missense probably benign
R6140:Olfr1082 UTSW 2 86594104 nonsense probably null
R6313:Olfr1082 UTSW 2 86594067 missense possibly damaging 0.76
R6528:Olfr1082 UTSW 2 86594465 missense probably damaging 1.00
R6785:Olfr1082 UTSW 2 86594421 missense probably damaging 0.98
R6792:Olfr1082 UTSW 2 86593939 missense probably benign 0.09
R6857:Olfr1082 UTSW 2 86594264 missense probably damaging 1.00
R6998:Olfr1082 UTSW 2 86594144 missense probably damaging 1.00
R7241:Olfr1082 UTSW 2 86594154 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCTCACTGCCAATGAACAGAA -3'
(R):5'- AACATTGGAATTGTTTTGTCCTTCA -3'

Sequencing Primer
(F):5'- CTGTGTAGCACAAAGAGAGTAGG -3'
(R):5'- CCTCTGCTAATGACAGGT -3'
Posted On2014-11-12