Incidental Mutation 'R2430:Olfr1140'
List |< first << previous [record 13 of 24] next >> last >|
ID250365
Institutional Source Beutler Lab
Gene Symbol Olfr1140
Ensembl Gene ENSMUSG00000068817
Gene Nameolfactory receptor 1140
SynonymsMOR177-6, GA_x6K02T2Q125-49250025-49250960
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R2430 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87743752-87747581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87746655 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 153 (M153K)
Ref Sequence ENSEMBL: ENSMUSP00000149645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111568] [ENSMUST00000214723] [ENSMUST00000217572]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111568
AA Change: M153K

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107194
Gene: ENSMUSG00000068815
AA Change: M153K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-44 PFAM
Pfam:7tm_1 41 290 2.8e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214723
AA Change: M153K

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217102
Predicted Effect possibly damaging
Transcript: ENSMUST00000217572
AA Change: M153K

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217634
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc T C 15: 74,671,891 E161G probably benign Het
Ass1 A G 2: 31,501,496 H261R probably damaging Het
Car11 T A 7: 45,703,648 probably null Het
Crebbp T C 16: 4,096,465 H844R probably damaging Het
Dnaic2 A G 11: 114,757,186 probably benign Het
Eya2 T C 2: 165,716,130 probably null Het
Klhl40 A G 9: 121,780,601 D484G possibly damaging Het
Knstrn A G 2: 118,834,103 probably benign Het
Nckap5 A G 1: 125,914,757 S1838P probably damaging Het
Nipsnap2 A G 5: 129,744,791 D117G possibly damaging Het
Nudt15 C T 14: 73,525,302 probably benign Het
Olfr1082 A G 2: 86,594,708 I40T probably benign Het
Pcdh20 T C 14: 88,467,548 D772G probably damaging Het
Pdss1 T A 2: 22,929,593 Y289* probably null Het
Phc2 A T 4: 128,707,983 Y77F probably damaging Het
Ppip5k2 A T 1: 97,735,030 Y667N probably damaging Het
Prdm2 A G 4: 143,133,163 S1186P possibly damaging Het
Prr36 A T 8: 4,213,488 probably benign Het
Reck C T 4: 43,930,202 T592I possibly damaging Het
Rprd2 T A 3: 95,764,795 K1015* probably null Het
Tfrc T G 16: 32,626,711 Y617D probably damaging Het
Tnfsf11 A C 14: 78,284,312 D152E probably benign Het
Vmn2r54 T A 7: 12,632,006 I334F probably damaging Het
Other mutations in Olfr1140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Olfr1140 APN 2 87747125 missense probably benign 0.03
IGL01538:Olfr1140 APN 2 87746598 missense probably benign 0.10
IGL01735:Olfr1140 APN 2 87746306 missense probably benign 0.00
IGL02224:Olfr1140 APN 2 87746413 nonsense probably null
IGL03047:Olfr1140 UTSW 2 87746994 missense possibly damaging 0.63
R0537:Olfr1140 UTSW 2 87746673 missense probably benign 0.06
R1701:Olfr1140 UTSW 2 87746550 missense probably damaging 0.99
R1998:Olfr1140 UTSW 2 87746972 missense probably damaging 1.00
R4750:Olfr1140 UTSW 2 87746508 missense probably benign
R5048:Olfr1140 UTSW 2 87746319 missense probably benign 0.01
R5494:Olfr1140 UTSW 2 87746606 missense probably damaging 1.00
R5521:Olfr1140 UTSW 2 87747062 missense probably benign 0.24
R7786:Olfr1140 UTSW 2 87746301 missense probably damaging 1.00
R8017:Olfr1140 UTSW 2 87747048 missense probably damaging 0.98
R8019:Olfr1140 UTSW 2 87747048 missense probably damaging 0.98
X0019:Olfr1140 UTSW 2 87746420 missense possibly damaging 0.96
Z1088:Olfr1140 UTSW 2 87746489 missense probably damaging 0.99
Z1177:Olfr1140 UTSW 2 87746624 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGTTGGACCAAAGATGCTGG -3'
(R):5'- GAAGTCCTGAAATAGTGCACAAC -3'

Sequencing Primer
(F):5'- GCTGGTAGATTTACTGGCCAAACAC -3'
(R):5'- GTCCTGAAATAGTGCACAACTCAAC -3'
Posted On2014-11-12