Incidental Mutation 'R2430:Knstrn'
List |< first << previous [record 8 of 24] next >> last >|
ID250366
Institutional Source Beutler Lab
Gene Symbol Knstrn
Ensembl Gene ENSMUSG00000027331
Gene Namekinetochore-localized astrin/SPAG5 binding
Synonyms1700025D04Rik, D2Ertd750e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2430 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location118814003-118853957 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 118834103 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028803] [ENSMUST00000110842] [ENSMUST00000123104] [ENSMUST00000134661] [ENSMUST00000148877] [ENSMUST00000176463]
Predicted Effect probably benign
Transcript: ENSMUST00000028803
SMART Domains Protein: ENSMUSP00000028803
Gene: ENSMUSG00000027331

DomainStartEndE-ValueType
coiled coil region 118 159 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000110842
AA Change: E226G
SMART Domains Protein: ENSMUSP00000106466
Gene: ENSMUSG00000027331
AA Change: E226G

DomainStartEndE-ValueType
coiled coil region 91 132 N/A INTRINSIC
coiled coil region 168 210 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123104
SMART Domains Protein: ENSMUSP00000135422
Gene: ENSMUSG00000027331

DomainStartEndE-ValueType
coiled coil region 104 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126045
SMART Domains Protein: ENSMUSP00000122844
Gene: ENSMUSG00000027331

DomainStartEndE-ValueType
coiled coil region 110 151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133534
Predicted Effect probably benign
Transcript: ENSMUST00000134579
Predicted Effect unknown
Transcript: ENSMUST00000134661
AA Change: E304G
SMART Domains Protein: ENSMUSP00000115860
Gene: ENSMUSG00000027331
AA Change: E304G

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
coiled coil region 169 210 N/A INTRINSIC
coiled coil region 246 288 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000148877
AA Change: E10G
Predicted Effect unknown
Transcript: ENSMUST00000176463
AA Change: E50G
SMART Domains Protein: ENSMUSP00000135549
Gene: ENSMUSG00000027331
AA Change: E50G

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
low complexity region 49 58 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177103
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display reduced fertility, decreased testis size, oligozoospermia, and defects in early spermatogenesis associated with abnormal spermatogonia proliferation and increased testis apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc T C 15: 74,671,891 E161G probably benign Het
Ass1 A G 2: 31,501,496 H261R probably damaging Het
Car11 T A 7: 45,703,648 probably null Het
Crebbp T C 16: 4,096,465 H844R probably damaging Het
Dnaic2 A G 11: 114,757,186 probably benign Het
Eya2 T C 2: 165,716,130 probably null Het
Klhl40 A G 9: 121,780,601 D484G possibly damaging Het
Nckap5 A G 1: 125,914,757 S1838P probably damaging Het
Nipsnap2 A G 5: 129,744,791 D117G possibly damaging Het
Nudt15 C T 14: 73,525,302 probably benign Het
Olfr1082 A G 2: 86,594,708 I40T probably benign Het
Olfr1140 T A 2: 87,746,655 M153K possibly damaging Het
Pcdh20 T C 14: 88,467,548 D772G probably damaging Het
Pdss1 T A 2: 22,929,593 Y289* probably null Het
Phc2 A T 4: 128,707,983 Y77F probably damaging Het
Ppip5k2 A T 1: 97,735,030 Y667N probably damaging Het
Prdm2 A G 4: 143,133,163 S1186P possibly damaging Het
Prr36 A T 8: 4,213,488 probably benign Het
Reck C T 4: 43,930,202 T592I possibly damaging Het
Rprd2 T A 3: 95,764,795 K1015* probably null Het
Tfrc T G 16: 32,626,711 Y617D probably damaging Het
Tnfsf11 A C 14: 78,284,312 D152E probably benign Het
Vmn2r54 T A 7: 12,632,006 I334F probably damaging Het
Other mutations in Knstrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02370:Knstrn APN 2 118823788 critical splice donor site probably null
Lychee UTSW 2 118830980 intron probably benign
R0529:Knstrn UTSW 2 118830980 intron probably benign
R2202:Knstrn UTSW 2 118830975 splice site probably null
R2203:Knstrn UTSW 2 118830975 splice site probably null
R2204:Knstrn UTSW 2 118830975 splice site probably null
R4672:Knstrn UTSW 2 118834031 missense probably damaging 0.98
R4672:Knstrn UTSW 2 118834032 missense possibly damaging 0.93
R5554:Knstrn UTSW 2 118833963 intron probably benign
R5954:Knstrn UTSW 2 118830955 intron probably benign
R6695:Knstrn UTSW 2 118814242 missense probably damaging 0.99
R6981:Knstrn UTSW 2 118834094 missense possibly damaging 0.80
R7269:Knstrn UTSW 2 118831388 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTCTATGTAGCACGGGTATAACGG -3'
(R):5'- CATCTGAAGGTGGGGCAATC -3'

Sequencing Primer
(F):5'- CACGGGTATAACGGTCTGGTC -3'
(R):5'- TCTGCTTAAAGGAGGAACCCCAG -3'
Posted On2014-11-12