Incidental Mutation 'R2430:Eya2'
ID250367
Institutional Source Beutler Lab
Gene Symbol Eya2
Ensembl Gene ENSMUSG00000017897
Gene NameEYA transcriptional coactivator and phosphatase 2
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.778) question?
Stock #R2430 (G1)
Quality Score191
Status Not validated
Chromosome2
Chromosomal Location165595032-165771727 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 165716130 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000085455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063433] [ENSMUST00000088132]
Predicted Effect probably null
Transcript: ENSMUST00000063433
SMART Domains Protein: ENSMUSP00000066244
Gene: ENSMUSG00000017897

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
PDB:4EGC|B 247 532 N/A PDB
SCOP:d1lvha_ 367 511 3e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000088132
SMART Domains Protein: ENSMUSP00000085455
Gene: ENSMUSG00000017897

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
Pfam:Hydrolase 262 508 1.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150669
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the eyes absent protein family. The encoded protein is a tyrosine phosphatase which acts as a transcriptional activator during development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc T C 15: 74,671,891 E161G probably benign Het
Ass1 A G 2: 31,501,496 H261R probably damaging Het
Car11 T A 7: 45,703,648 probably null Het
Crebbp T C 16: 4,096,465 H844R probably damaging Het
Dnaic2 A G 11: 114,757,186 probably benign Het
Klhl40 A G 9: 121,780,601 D484G possibly damaging Het
Knstrn A G 2: 118,834,103 probably benign Het
Nckap5 A G 1: 125,914,757 S1838P probably damaging Het
Nipsnap2 A G 5: 129,744,791 D117G possibly damaging Het
Nudt15 C T 14: 73,525,302 probably benign Het
Olfr1082 A G 2: 86,594,708 I40T probably benign Het
Olfr1140 T A 2: 87,746,655 M153K possibly damaging Het
Pcdh20 T C 14: 88,467,548 D772G probably damaging Het
Pdss1 T A 2: 22,929,593 Y289* probably null Het
Phc2 A T 4: 128,707,983 Y77F probably damaging Het
Ppip5k2 A T 1: 97,735,030 Y667N probably damaging Het
Prdm2 A G 4: 143,133,163 S1186P possibly damaging Het
Prr36 A T 8: 4,213,488 probably benign Het
Reck C T 4: 43,930,202 T592I possibly damaging Het
Rprd2 T A 3: 95,764,795 K1015* probably null Het
Tfrc T G 16: 32,626,711 Y617D probably damaging Het
Tnfsf11 A C 14: 78,284,312 D152E probably benign Het
Vmn2r54 T A 7: 12,632,006 I334F probably damaging Het
Other mutations in Eya2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Eya2 APN 2 165754481 missense probably damaging 1.00
IGL02368:Eya2 APN 2 165763718 missense probably damaging 1.00
IGL02465:Eya2 APN 2 165715952 missense possibly damaging 0.89
IGL02523:Eya2 APN 2 165754436 splice site probably benign
Needle UTSW 2 165763816 missense probably damaging 1.00
R0048:Eya2 UTSW 2 165716011 missense probably damaging 1.00
R0167:Eya2 UTSW 2 165716112 missense possibly damaging 0.89
R0479:Eya2 UTSW 2 165715956 nonsense probably null
R0600:Eya2 UTSW 2 165769237 missense probably damaging 1.00
R0909:Eya2 UTSW 2 165754493 missense probably benign 0.28
R1251:Eya2 UTSW 2 165754484 missense probably damaging 1.00
R1332:Eya2 UTSW 2 165687608 splice site probably benign
R1725:Eya2 UTSW 2 165724685 missense probably benign
R1729:Eya2 UTSW 2 165687663 missense probably damaging 1.00
R1730:Eya2 UTSW 2 165687663 missense probably damaging 1.00
R1739:Eya2 UTSW 2 165687663 missense probably damaging 1.00
R1765:Eya2 UTSW 2 165724803 missense probably damaging 0.99
R1879:Eya2 UTSW 2 165664806 missense probably benign
R1969:Eya2 UTSW 2 165716119 missense probably benign 0.00
R4285:Eya2 UTSW 2 165724780 missense probably benign 0.01
R5137:Eya2 UTSW 2 165731628 missense probably damaging 1.00
R5574:Eya2 UTSW 2 165763816 missense probably damaging 1.00
R5739:Eya2 UTSW 2 165761937 missense probably damaging 1.00
R5943:Eya2 UTSW 2 165724689 missense probably damaging 0.99
R6259:Eya2 UTSW 2 165716099 missense probably benign 0.00
R6477:Eya2 UTSW 2 165763761 missense probably benign
R6736:Eya2 UTSW 2 165716037 missense possibly damaging 0.80
R7347:Eya2 UTSW 2 165687666 missense probably benign 0.00
R7524:Eya2 UTSW 2 165769326 critical splice donor site probably null
R7563:Eya2 UTSW 2 165716130 critical splice donor site probably null
R7612:Eya2 UTSW 2 165687737 critical splice donor site probably null
R8420:Eya2 UTSW 2 165767068 missense probably damaging 1.00
Z1177:Eya2 UTSW 2 165685593 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCAGGATTATCCGTCCTAC -3'
(R):5'- TAAAGAAATCTTCAGAGGCCCC -3'

Sequencing Primer
(F):5'- AGGATTATCCGTCCTACCCCAG -3'
(R):5'- AGTTGTTCACCAAGGACTGC -3'
Posted On2014-11-12