Incidental Mutation 'R2430:Reck'
ID250370
Institutional Source Beutler Lab
Gene Symbol Reck
Ensembl Gene ENSMUSG00000028476
Gene Namereversion-inducing-cysteine-rich protein with kazal motifs
SynonymsSt15
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2430 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43875530-43944806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43930202 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 592 (T592I)
Ref Sequence ENSEMBL: ENSMUSP00000030198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030198
AA Change: T592I

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030198
Gene: ENSMUSG00000028476
AA Change: T592I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
KAZAL 632 671 1.18e-2 SMART
KAZAL 708 750 1.46e-2 SMART
KAZAL 753 787 4.26e-2 SMART
low complexity region 877 890 N/A INTRINSIC
low complexity region 927 946 N/A INTRINSIC
low complexity region 950 967 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128463
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cysteine-rich, extracellular protein with protease inhibitor-like domains whose expression is suppressed strongly in many tumors and cells transformed by various kinds of oncogenes. In normal cells, this membrane-anchored glycoprotein may serve as a negative regulator for matrix metalloproteinase-9, a key enzyme involved in tumor invasion and metastasis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality around E10.5-E11.5, defects in collagen fibrils, basal lamina and vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc T C 15: 74,671,891 E161G probably benign Het
Ass1 A G 2: 31,501,496 H261R probably damaging Het
Car11 T A 7: 45,703,648 probably null Het
Crebbp T C 16: 4,096,465 H844R probably damaging Het
Dnaic2 A G 11: 114,757,186 probably benign Het
Eya2 T C 2: 165,716,130 probably null Het
Klhl40 A G 9: 121,780,601 D484G possibly damaging Het
Knstrn A G 2: 118,834,103 probably benign Het
Nckap5 A G 1: 125,914,757 S1838P probably damaging Het
Nipsnap2 A G 5: 129,744,791 D117G possibly damaging Het
Nudt15 C T 14: 73,525,302 probably benign Het
Olfr1082 A G 2: 86,594,708 I40T probably benign Het
Olfr1140 T A 2: 87,746,655 M153K possibly damaging Het
Pcdh20 T C 14: 88,467,548 D772G probably damaging Het
Pdss1 T A 2: 22,929,593 Y289* probably null Het
Phc2 A T 4: 128,707,983 Y77F probably damaging Het
Ppip5k2 A T 1: 97,735,030 Y667N probably damaging Het
Prdm2 A G 4: 143,133,163 S1186P possibly damaging Het
Prr36 A T 8: 4,213,488 probably benign Het
Rprd2 T A 3: 95,764,795 K1015* probably null Het
Tfrc T G 16: 32,626,711 Y617D probably damaging Het
Tnfsf11 A C 14: 78,284,312 D152E probably benign Het
Vmn2r54 T A 7: 12,632,006 I334F probably damaging Het
Other mutations in Reck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Reck APN 4 43940662 missense probably damaging 1.00
IGL01569:Reck APN 4 43925172 missense probably benign 0.00
IGL02341:Reck APN 4 43925160 missense probably damaging 0.97
IGL02637:Reck APN 4 43898009 missense probably damaging 0.97
IGL02709:Reck APN 4 43913791 missense probably damaging 0.99
IGL02829:Reck APN 4 43891014 missense probably damaging 0.96
IGL02928:Reck APN 4 43912078 missense possibly damaging 0.47
IGL03132:Reck APN 4 43938898 nonsense probably null
PIT4453001:Reck UTSW 4 43895850 missense probably benign 0.00
R0066:Reck UTSW 4 43930936 missense probably damaging 0.97
R0066:Reck UTSW 4 43930936 missense probably damaging 0.97
R0607:Reck UTSW 4 43940719 missense probably benign 0.01
R0626:Reck UTSW 4 43930295 missense probably benign 0.00
R0894:Reck UTSW 4 43922967 missense probably damaging 1.00
R0932:Reck UTSW 4 43922838 missense possibly damaging 0.95
R1564:Reck UTSW 4 43912061 missense probably benign 0.00
R1633:Reck UTSW 4 43922964 missense possibly damaging 0.89
R1772:Reck UTSW 4 43890982 missense probably benign 0.00
R1968:Reck UTSW 4 43913771 splice site probably null
R2105:Reck UTSW 4 43943195 missense probably damaging 0.99
R2225:Reck UTSW 4 43922837 missense probably benign 0.01
R2302:Reck UTSW 4 43931015 missense probably benign 0.28
R2655:Reck UTSW 4 43938966 missense probably benign 0.01
R3858:Reck UTSW 4 43930261 missense probably benign 0.13
R4027:Reck UTSW 4 43922931 missense probably damaging 1.00
R4028:Reck UTSW 4 43922931 missense probably damaging 1.00
R4029:Reck UTSW 4 43922931 missense probably damaging 1.00
R4080:Reck UTSW 4 43942293 missense possibly damaging 0.95
R4497:Reck UTSW 4 43891001 missense probably benign
R4583:Reck UTSW 4 43931062 critical splice donor site probably null
R4702:Reck UTSW 4 43898060 missense probably damaging 1.00
R5934:Reck UTSW 4 43930979 missense probably damaging 1.00
R6114:Reck UTSW 4 43922895 missense probably damaging 1.00
R6235:Reck UTSW 4 43937450 missense probably damaging 1.00
R7895:Reck UTSW 4 43890970 missense probably benign 0.00
R7903:Reck UTSW 4 43927166 missense possibly damaging 0.49
R8047:Reck UTSW 4 43927221 missense probably damaging 1.00
X0062:Reck UTSW 4 43922921 missense probably damaging 1.00
X0067:Reck UTSW 4 43914016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTAGATTTAGGCCCCTAGTTT -3'
(R):5'- TGCAGTGCCTGGGAGAGAA -3'

Sequencing Primer
(F):5'- AAACCTGACCTGAGTGTGCTC -3'
(R):5'- TGCCTGGGAGAGAACAAGTGC -3'
Posted On2014-11-12