Incidental Mutation 'R2430:Nipsnap2'
List |< first << previous [record 10 of 24] next >> last >|
ID250373
Institutional Source Beutler Lab
Gene Symbol Nipsnap2
Ensembl Gene ENSMUSG00000029432
Gene Namenipsnap homolog 2
SynonymsGbas, Nipsnap2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2430 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location129725063-129758327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129744791 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 117 (D117G)
Ref Sequence ENSEMBL: ENSMUSP00000141131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086046] [ENSMUST00000124342] [ENSMUST00000186265] [ENSMUST00000195946]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086046
AA Change: D117G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000083211
Gene: ENSMUSG00000029432
AA Change: D117G

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:NIPSNAP 182 279 2.6e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124342
AA Change: D117G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117705
Gene: ENSMUSG00000029432
AA Change: D117G

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:NIPSNAP 182 279 2.8e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000186265
AA Change: D117G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141131
Gene: ENSMUSG00000029432
AA Change: D117G

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:NIPSNAP 182 279 2.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195946
SMART Domains Protein: ENSMUSP00000142916
Gene: ENSMUSG00000029432

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NipSnap family of proteins that may be involved in vesicular transport. The encoded protein is localized to mitochondria and plays a role in oxidative phosphorylation. A pseudogene of this gene is located on the long arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc T C 15: 74,671,891 E161G probably benign Het
Ass1 A G 2: 31,501,496 H261R probably damaging Het
Car11 T A 7: 45,703,648 probably null Het
Crebbp T C 16: 4,096,465 H844R probably damaging Het
Dnaic2 A G 11: 114,757,186 probably benign Het
Eya2 T C 2: 165,716,130 probably null Het
Klhl40 A G 9: 121,780,601 D484G possibly damaging Het
Knstrn A G 2: 118,834,103 probably benign Het
Nckap5 A G 1: 125,914,757 S1838P probably damaging Het
Nudt15 C T 14: 73,525,302 probably benign Het
Olfr1082 A G 2: 86,594,708 I40T probably benign Het
Olfr1140 T A 2: 87,746,655 M153K possibly damaging Het
Pcdh20 T C 14: 88,467,548 D772G probably damaging Het
Pdss1 T A 2: 22,929,593 Y289* probably null Het
Phc2 A T 4: 128,707,983 Y77F probably damaging Het
Ppip5k2 A T 1: 97,735,030 Y667N probably damaging Het
Prdm2 A G 4: 143,133,163 S1186P possibly damaging Het
Prr36 A T 8: 4,213,488 probably benign Het
Reck C T 4: 43,930,202 T592I possibly damaging Het
Rprd2 T A 3: 95,764,795 K1015* probably null Het
Tfrc T G 16: 32,626,711 Y617D probably damaging Het
Tnfsf11 A C 14: 78,284,312 D152E probably benign Het
Vmn2r54 T A 7: 12,632,006 I334F probably damaging Het
Other mutations in Nipsnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Nipsnap2 APN 5 129754851 missense probably damaging 0.99
IGL01012:Nipsnap2 APN 5 129746439 missense possibly damaging 0.91
IGL01320:Nipsnap2 APN 5 129744764 missense probably damaging 1.00
IGL01321:Nipsnap2 APN 5 129757141 makesense probably null
IGL02119:Nipsnap2 APN 5 129747992 splice site probably benign
IGL02636:Nipsnap2 APN 5 129745290 intron probably benign
R0540:Nipsnap2 UTSW 5 129754845 missense probably damaging 1.00
R1497:Nipsnap2 UTSW 5 129753218 intron probably benign
R1649:Nipsnap2 UTSW 5 129753237 missense probably damaging 0.99
R1743:Nipsnap2 UTSW 5 129757085 missense probably damaging 1.00
R2020:Nipsnap2 UTSW 5 129753223 splice site probably null
R2187:Nipsnap2 UTSW 5 129746473 splice site probably null
R2215:Nipsnap2 UTSW 5 129739585 missense probably damaging 1.00
R3124:Nipsnap2 UTSW 5 129748034 critical splice donor site probably null
R5072:Nipsnap2 UTSW 5 129739580 missense probably damaging 1.00
R5150:Nipsnap2 UTSW 5 129757111 missense probably benign 0.03
R5823:Nipsnap2 UTSW 5 129739769 splice site probably null
R6736:Nipsnap2 UTSW 5 129745288 critical splice donor site probably null
R6913:Nipsnap2 UTSW 5 129753293 missense probably benign 0.11
R7163:Nipsnap2 UTSW 5 129744710 missense probably benign 0.00
R7597:Nipsnap2 UTSW 5 129739573 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAGTGGTTTGCATTCC -3'
(R):5'- TAGTGTGCCTCGTATCTGCC -3'

Sequencing Primer
(F):5'- GTTTGCATTCCAGCTGATGC -3'
(R):5'- GTTTCCATAACAGATTCGGGC -3'
Posted On2014-11-12