Incidental Mutation 'R2430:Car11'
ID250375
Institutional Source Beutler Lab
Gene Symbol Car11
Ensembl Gene ENSMUSG00000003273
Gene Namecarbonic anhydrase 11
SynonymsCA-RP XI
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R2430 (G1)
Quality Score131
Status Not validated
Chromosome7
Chromosomal Location45699843-45704682 bp(+) (GRCm38)
Type of Mutationsplice site (35 bp from exon)
DNA Base Change (assembly) T to A at 45703648 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000003360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003360] [ENSMUST00000080885] [ENSMUST00000211357] [ENSMUST00000211513]
Predicted Effect probably null
Transcript: ENSMUST00000003360
SMART Domains Protein: ENSMUSP00000003360
Gene: ENSMUSG00000003273

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Carb_anhydrase 35 303 1.1e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080885
SMART Domains Protein: ENSMUSP00000079693
Gene: ENSMUSG00000059824

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
low complexity region 71 98 N/A INTRINSIC
low complexity region 127 171 N/A INTRINSIC
BRLZ 253 317 5.17e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209796
Predicted Effect probably benign
Transcript: ENSMUST00000210027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211259
Predicted Effect probably benign
Transcript: ENSMUST00000211357
Predicted Effect probably benign
Transcript: ENSMUST00000211513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211748
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA XI is likely a secreted protein, however, radical changes at active site residues completely conserved in CA isozymes with catalytic activity, make it unlikely that it has carbonic anhydrase activity. It shares properties in common with two other acatalytic CA isoforms, CA VIII and CA X. CA XI is most abundantly expressed in brain, and may play a general role in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc T C 15: 74,671,891 E161G probably benign Het
Ass1 A G 2: 31,501,496 H261R probably damaging Het
Crebbp T C 16: 4,096,465 H844R probably damaging Het
Dnaic2 A G 11: 114,757,186 probably benign Het
Eya2 T C 2: 165,716,130 probably null Het
Klhl40 A G 9: 121,780,601 D484G possibly damaging Het
Knstrn A G 2: 118,834,103 probably benign Het
Nckap5 A G 1: 125,914,757 S1838P probably damaging Het
Nipsnap2 A G 5: 129,744,791 D117G possibly damaging Het
Nudt15 C T 14: 73,525,302 probably benign Het
Olfr1082 A G 2: 86,594,708 I40T probably benign Het
Olfr1140 T A 2: 87,746,655 M153K possibly damaging Het
Pcdh20 T C 14: 88,467,548 D772G probably damaging Het
Pdss1 T A 2: 22,929,593 Y289* probably null Het
Phc2 A T 4: 128,707,983 Y77F probably damaging Het
Ppip5k2 A T 1: 97,735,030 Y667N probably damaging Het
Prdm2 A G 4: 143,133,163 S1186P possibly damaging Het
Prr36 A T 8: 4,213,488 probably benign Het
Reck C T 4: 43,930,202 T592I possibly damaging Het
Rprd2 T A 3: 95,764,795 K1015* probably null Het
Tfrc T G 16: 32,626,711 Y617D probably damaging Het
Tnfsf11 A C 14: 78,284,312 D152E probably benign Het
Vmn2r54 T A 7: 12,632,006 I334F probably damaging Het
Other mutations in Car11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02195:Car11 APN 7 45701292 missense probably damaging 0.97
IGL03189:Car11 APN 7 45702455 missense probably damaging 0.98
R1201:Car11 UTSW 7 45703480 missense probably benign
R1625:Car11 UTSW 7 45701307 missense probably benign 0.04
R1670:Car11 UTSW 7 45703525 missense possibly damaging 0.52
R2509:Car11 UTSW 7 45701359 missense probably damaging 0.96
R2510:Car11 UTSW 7 45701359 missense probably damaging 0.96
R2680:Car11 UTSW 7 45702485 missense probably benign
R3926:Car11 UTSW 7 45700491 missense probably benign 0.17
R5511:Car11 UTSW 7 45700461 missense probably damaging 1.00
R5639:Car11 UTSW 7 45702621 critical splice donor site probably null
R7395:Car11 UTSW 7 45701321 nonsense probably null
R7490:Car11 UTSW 7 45700318 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCTTCAAGACCTGAGCCTG -3'
(R):5'- TACCATGCAGGCGGTAGTTG -3'

Sequencing Primer
(F):5'- GGAGCTCCTGTTCCCAGAATC -3'
(R):5'- GGTCCCTGTTGCCCCTCAAG -3'
Posted On2014-11-12