Incidental Mutation 'R2430:Prr36'
ID250376
Institutional Source Beutler Lab
Gene Symbol Prr36
Ensembl Gene ENSMUSG00000064125
Gene Nameproline rich 36
SynonymsBC068157
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R2430 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location4209543-4217459 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 4213488 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168386] [ENSMUST00000175906] [ENSMUST00000176227] [ENSMUST00000177491]
Predicted Effect unknown
Transcript: ENSMUST00000168386
AA Change: L726Q
SMART Domains Protein: ENSMUSP00000133114
Gene: ENSMUSG00000064125
AA Change: L726Q

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 5.9e-10 PROSPERO
internal_repeat_1 87 106 5.9e-10 PROSPERO
low complexity region 109 123 N/A INTRINSIC
low complexity region 358 388 N/A INTRINSIC
low complexity region 390 425 N/A INTRINSIC
low complexity region 466 497 N/A INTRINSIC
low complexity region 543 567 N/A INTRINSIC
low complexity region 571 612 N/A INTRINSIC
low complexity region 647 726 N/A INTRINSIC
low complexity region 733 751 N/A INTRINSIC
low complexity region 755 780 N/A INTRINSIC
low complexity region 783 867 N/A INTRINSIC
low complexity region 1020 1045 N/A INTRINSIC
Pfam:DUF4596 1053 1098 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175906
SMART Domains Protein: ENSMUSP00000135713
Gene: ENSMUSG00000064125

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 5.38e-8 PROSPERO
internal_repeat_1 87 106 5.38e-8 PROSPERO
low complexity region 109 123 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176227
Predicted Effect probably benign
Transcript: ENSMUST00000176645
Predicted Effect probably benign
Transcript: ENSMUST00000177491
SMART Domains Protein: ENSMUSP00000135130
Gene: ENSMUSG00000064125

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 1.65e-6 PROSPERO
internal_repeat_1 87 106 1.65e-6 PROSPERO
low complexity region 109 123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein of unknown function that contains internal regions of low complexity sequence. Alternative splicing results in multiple transcript variants. The transcript structure of the protein-coding variant at this locus is conserved between human and mouse. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc T C 15: 74,671,891 E161G probably benign Het
Ass1 A G 2: 31,501,496 H261R probably damaging Het
Car11 T A 7: 45,703,648 probably null Het
Crebbp T C 16: 4,096,465 H844R probably damaging Het
Dnaic2 A G 11: 114,757,186 probably benign Het
Eya2 T C 2: 165,716,130 probably null Het
Klhl40 A G 9: 121,780,601 D484G possibly damaging Het
Knstrn A G 2: 118,834,103 probably benign Het
Nckap5 A G 1: 125,914,757 S1838P probably damaging Het
Nipsnap2 A G 5: 129,744,791 D117G possibly damaging Het
Nudt15 C T 14: 73,525,302 probably benign Het
Olfr1082 A G 2: 86,594,708 I40T probably benign Het
Olfr1140 T A 2: 87,746,655 M153K possibly damaging Het
Pcdh20 T C 14: 88,467,548 D772G probably damaging Het
Pdss1 T A 2: 22,929,593 Y289* probably null Het
Phc2 A T 4: 128,707,983 Y77F probably damaging Het
Ppip5k2 A T 1: 97,735,030 Y667N probably damaging Het
Prdm2 A G 4: 143,133,163 S1186P possibly damaging Het
Reck C T 4: 43,930,202 T592I possibly damaging Het
Rprd2 T A 3: 95,764,795 K1015* probably null Het
Tfrc T G 16: 32,626,711 Y617D probably damaging Het
Tnfsf11 A C 14: 78,284,312 D152E probably benign Het
Vmn2r54 T A 7: 12,632,006 I334F probably damaging Het
Other mutations in Prr36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Prr36 APN 8 4216230 missense probably benign 0.01
IGL01535:Prr36 APN 8 4214043 unclassified probably benign
IGL01658:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01710:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01712:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01713:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01892:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01893:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL02496:Prr36 APN 8 4216407 nonsense probably null
IGL02829:Prr36 APN 8 4215278 missense possibly damaging 0.55
R0479:Prr36 UTSW 8 4213930 nonsense probably null
R0667:Prr36 UTSW 8 4216311 unclassified probably benign
R0784:Prr36 UTSW 8 4213771 unclassified probably benign
R1737:Prr36 UTSW 8 4214370 unclassified probably benign
R2017:Prr36 UTSW 8 4215205 missense probably benign 0.02
R2032:Prr36 UTSW 8 4214304 unclassified probably benign
R4160:Prr36 UTSW 8 4212910 missense probably benign 0.10
R4184:Prr36 UTSW 8 4213409 unclassified probably benign
R4393:Prr36 UTSW 8 4214901 unclassified probably benign
R4887:Prr36 UTSW 8 4210881 missense probably benign 0.01
R5508:Prr36 UTSW 8 4216488 missense probably damaging 0.99
R5628:Prr36 UTSW 8 4216273 small deletion probably benign
R6189:Prr36 UTSW 8 4214177 unclassified probably benign
R6277:Prr36 UTSW 8 4214746 unclassified probably benign
R7185:Prr36 UTSW 8 4216458 missense probably damaging 1.00
R7286:Prr36 UTSW 8 4215163 critical splice donor site probably benign
R7338:Prr36 UTSW 8 4216212 missense probably damaging 1.00
R7604:Prr36 UTSW 8 4214836 missense unknown
R7621:Prr36 UTSW 8 4213150 missense unknown
R7699:Prr36 UTSW 8 4213989 missense unknown
R7703:Prr36 UTSW 8 4212982 missense probably benign 0.03
R7842:Prr36 UTSW 8 4210953 missense probably benign 0.09
R7853:Prr36 UTSW 8 4213905 missense unknown
R8325:Prr36 UTSW 8 4212982 missense probably benign 0.03
R8340:Prr36 UTSW 8 4214224 missense unknown
RF044:Prr36 UTSW 8 4216273 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CCACAAGGGGAATCTGTAGG -3'
(R):5'- GGCACCTCCTGTTACATACC -3'

Sequencing Primer
(F):5'- CAGGGTATTGTCAGAGGAG -3'
(R):5'- GCACCTCCTGTTACATACCCCTTG -3'
Posted On2014-11-12