Incidental Mutation 'R2430:Klhl40'
ID250378
Institutional Source Beutler Lab
Gene Symbol Klhl40
Ensembl Gene ENSMUSG00000074001
Gene Namekelch-like 40
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R2430 (G1)
Quality Score215
Status Not validated
Chromosome9
Chromosomal Location121777607-121783818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121780601 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 484 (D484G)
Ref Sequence ENSEMBL: ENSMUSP00000095873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035110] [ENSMUST00000098272] [ENSMUST00000163981]
Predicted Effect probably benign
Transcript: ENSMUST00000035110
SMART Domains Protein: ENSMUSP00000035110
Gene: ENSMUSG00000032523

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
Pfam:MBOAT 63 448 2.7e-15 PFAM
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098272
AA Change: D484G

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095873
Gene: ENSMUSG00000074001
AA Change: D484G

DomainStartEndE-ValueType
BTB 33 128 4.61e-29 SMART
BACK 133 239 9.46e-30 SMART
low complexity region 262 276 N/A INTRINSIC
Blast:BTB 300 355 2e-27 BLAST
Kelch 360 412 1.77e0 SMART
Kelch 413 462 1.29e-2 SMART
Kelch 463 510 4.68e-9 SMART
Kelch 511 557 2.06e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163981
SMART Domains Protein: ENSMUSP00000131971
Gene: ENSMUSG00000032523

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Pfam:MBOAT 97 444 3.7e-16 PFAM
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216358
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a BACK domain, a BTB/POZ domain, and 5 Kelch repeats, however, its exact function is not known. The gene and the multi-domain protein structure are conserved across different taxa, including primates, rodents, chicken and zebrafish. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous disruption of this gene results in postnatal growth retardation, abnormal sarcomere morphology, skeletal muscle dysfunction, and complete postnatal lethality. Homozygotes for a null allele develop a nemaline-like myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc T C 15: 74,671,891 E161G probably benign Het
Ass1 A G 2: 31,501,496 H261R probably damaging Het
Car11 T A 7: 45,703,648 probably null Het
Crebbp T C 16: 4,096,465 H844R probably damaging Het
Dnaic2 A G 11: 114,757,186 probably benign Het
Eya2 T C 2: 165,716,130 probably null Het
Knstrn A G 2: 118,834,103 probably benign Het
Nckap5 A G 1: 125,914,757 S1838P probably damaging Het
Nipsnap2 A G 5: 129,744,791 D117G possibly damaging Het
Nudt15 C T 14: 73,525,302 probably benign Het
Olfr1082 A G 2: 86,594,708 I40T probably benign Het
Olfr1140 T A 2: 87,746,655 M153K possibly damaging Het
Pcdh20 T C 14: 88,467,548 D772G probably damaging Het
Pdss1 T A 2: 22,929,593 Y289* probably null Het
Phc2 A T 4: 128,707,983 Y77F probably damaging Het
Ppip5k2 A T 1: 97,735,030 Y667N probably damaging Het
Prdm2 A G 4: 143,133,163 S1186P possibly damaging Het
Prr36 A T 8: 4,213,488 probably benign Het
Reck C T 4: 43,930,202 T592I possibly damaging Het
Rprd2 T A 3: 95,764,795 K1015* probably null Het
Tfrc T G 16: 32,626,711 Y617D probably damaging Het
Tnfsf11 A C 14: 78,284,312 D152E probably benign Het
Vmn2r54 T A 7: 12,632,006 I334F probably damaging Het
Other mutations in Klhl40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Klhl40 APN 9 121778917 missense probably damaging 1.00
IGL02123:Klhl40 APN 9 121779923 missense probably benign 0.01
IGL03059:Klhl40 APN 9 121778137 missense probably damaging 1.00
IGL03124:Klhl40 APN 9 121780685 missense probably damaging 1.00
IGL03204:Klhl40 APN 9 121782630 missense probably benign 0.03
IGL03366:Klhl40 APN 9 121783380 missense probably damaging 1.00
R0506:Klhl40 UTSW 9 121778067 missense probably damaging 0.98
R1735:Klhl40 UTSW 9 121779938 missense probably benign 0.00
R3685:Klhl40 UTSW 9 121782658 missense probably damaging 1.00
R3839:Klhl40 UTSW 9 121780416 missense possibly damaging 0.93
R3929:Klhl40 UTSW 9 121780676 missense probably benign
R4326:Klhl40 UTSW 9 121778890 missense probably benign 0.37
R4328:Klhl40 UTSW 9 121778890 missense probably benign 0.37
R4664:Klhl40 UTSW 9 121780733 missense probably damaging 1.00
R4697:Klhl40 UTSW 9 121778734 missense probably damaging 1.00
R5228:Klhl40 UTSW 9 121777801 missense probably benign 0.02
R6198:Klhl40 UTSW 9 121778767 missense probably damaging 1.00
R6258:Klhl40 UTSW 9 121777960 missense probably damaging 1.00
R7992:Klhl40 UTSW 9 121778682 missense probably damaging 1.00
R8171:Klhl40 UTSW 9 121778557 missense probably benign 0.14
Z1177:Klhl40 UTSW 9 121780693 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ATTCAAATGGGGTGAGTCAGAC -3'
(R):5'- GCAGGGCAAAGATCATACTTG -3'

Sequencing Primer
(F):5'- TGTACGGCCACACAGTCC -3'
(R):5'- GCAGGGCAAAGATCATACTTGTTGTC -3'
Posted On2014-11-12