Incidental Mutation 'R2430:Dnaic2'
ID250379
Institutional Source Beutler Lab
Gene Symbol Dnaic2
Ensembl Gene ENSMUSG00000034706
Gene Namedynein, axonemal, intermediate chain 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R2430 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location114727408-114757889 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 114757186 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069325] [ENSMUST00000092469] [ENSMUST00000141762]
Predicted Effect unknown
Transcript: ENSMUST00000069325
AA Change: E596G
SMART Domains Protein: ENSMUSP00000065787
Gene: ENSMUSG00000034706
AA Change: E596G

DomainStartEndE-ValueType
low complexity region 127 146 N/A INTRINSIC
WD40 206 245 2.86e0 SMART
WD40 248 293 3.33e-1 SMART
WD40 353 392 7.92e-3 SMART
WD40 396 436 2.05e1 SMART
WD40 441 480 4.93e1 SMART
low complexity region 519 545 N/A INTRINSIC
low complexity region 559 608 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000092469
AA Change: E596G
SMART Domains Protein: ENSMUSP00000090126
Gene: ENSMUSG00000034706
AA Change: E596G

DomainStartEndE-ValueType
low complexity region 127 146 N/A INTRINSIC
WD40 206 245 2.86e0 SMART
WD40 248 293 3.33e-1 SMART
WD40 353 392 7.92e-3 SMART
WD40 396 436 2.05e1 SMART
WD40 441 480 4.93e1 SMART
low complexity region 519 545 N/A INTRINSIC
low complexity region 559 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136403
Predicted Effect probably benign
Transcript: ENSMUST00000141762
SMART Domains Protein: ENSMUSP00000114700
Gene: ENSMUSG00000034706

DomainStartEndE-ValueType
low complexity region 127 146 N/A INTRINSIC
WD40 206 245 2.86e0 SMART
WD40 248 293 3.33e-1 SMART
WD40 353 392 7.92e-3 SMART
WD40 396 436 2.05e1 SMART
low complexity region 458 476 N/A INTRINSIC
low complexity region 507 533 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144872
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dynein intermediate chain family, and is part of the dynein complex of respiratory cilia and sperm flagella. Mutations in this gene are associated with primary ciliary dyskinesia type 9. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit situs inversus totalis and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc T C 15: 74,671,891 E161G probably benign Het
Ass1 A G 2: 31,501,496 H261R probably damaging Het
Car11 T A 7: 45,703,648 probably null Het
Crebbp T C 16: 4,096,465 H844R probably damaging Het
Eya2 T C 2: 165,716,130 probably null Het
Klhl40 A G 9: 121,780,601 D484G possibly damaging Het
Knstrn A G 2: 118,834,103 probably benign Het
Nckap5 A G 1: 125,914,757 S1838P probably damaging Het
Nipsnap2 A G 5: 129,744,791 D117G possibly damaging Het
Nudt15 C T 14: 73,525,302 probably benign Het
Olfr1082 A G 2: 86,594,708 I40T probably benign Het
Olfr1140 T A 2: 87,746,655 M153K possibly damaging Het
Pcdh20 T C 14: 88,467,548 D772G probably damaging Het
Pdss1 T A 2: 22,929,593 Y289* probably null Het
Phc2 A T 4: 128,707,983 Y77F probably damaging Het
Ppip5k2 A T 1: 97,735,030 Y667N probably damaging Het
Prdm2 A G 4: 143,133,163 S1186P possibly damaging Het
Prr36 A T 8: 4,213,488 probably benign Het
Reck C T 4: 43,930,202 T592I possibly damaging Het
Rprd2 T A 3: 95,764,795 K1015* probably null Het
Tfrc T G 16: 32,626,711 Y617D probably damaging Het
Tnfsf11 A C 14: 78,284,312 D152E probably benign Het
Vmn2r54 T A 7: 12,632,006 I334F probably damaging Het
Other mutations in Dnaic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Dnaic2 APN 11 114751788 missense probably benign 0.37
IGL01548:Dnaic2 APN 11 114752942 missense probably damaging 1.00
IGL02719:Dnaic2 APN 11 114751911 missense probably damaging 1.00
IGL03236:Dnaic2 APN 11 114757249 unclassified probably benign
R0096:Dnaic2 UTSW 11 114754332 missense probably benign 0.04
R0096:Dnaic2 UTSW 11 114754332 missense probably benign 0.04
R0305:Dnaic2 UTSW 11 114752894 missense probably benign 0.09
R0472:Dnaic2 UTSW 11 114745189 splice site probably benign
R0711:Dnaic2 UTSW 11 114754332 missense probably benign 0.04
R1756:Dnaic2 UTSW 11 114750380 missense probably benign 0.02
R1861:Dnaic2 UTSW 11 114752951 missense possibly damaging 0.56
R1916:Dnaic2 UTSW 11 114732923 missense possibly damaging 0.88
R1981:Dnaic2 UTSW 11 114732929 missense probably damaging 1.00
R1983:Dnaic2 UTSW 11 114735856 splice site probably null
R2510:Dnaic2 UTSW 11 114757167 unclassified probably benign
R3001:Dnaic2 UTSW 11 114750471 missense probably damaging 1.00
R3002:Dnaic2 UTSW 11 114750471 missense probably damaging 1.00
R3113:Dnaic2 UTSW 11 114751930 splice site probably null
R3803:Dnaic2 UTSW 11 114738725 missense probably benign
R3874:Dnaic2 UTSW 11 114732955 missense probably damaging 1.00
R4853:Dnaic2 UTSW 11 114745091 missense probably benign 0.03
R5267:Dnaic2 UTSW 11 114740467 missense probably benign 0.02
R6008:Dnaic2 UTSW 11 114752990 missense probably benign 0.01
R6024:Dnaic2 UTSW 11 114752908 missense possibly damaging 0.85
R6819:Dnaic2 UTSW 11 114745091 missense probably benign 0.00
R7053:Dnaic2 UTSW 11 114738695 missense probably damaging 1.00
R7143:Dnaic2 UTSW 11 114754250 missense possibly damaging 0.86
R7208:Dnaic2 UTSW 11 114757162 missense unknown
R7275:Dnaic2 UTSW 11 114757228 missense unknown
R7463:Dnaic2 UTSW 11 114754406 missense probably benign 0.07
R7779:Dnaic2 UTSW 11 114754409 missense possibly damaging 0.50
R7899:Dnaic2 UTSW 11 114738630 missense probably benign 0.21
R8443:Dnaic2 UTSW 11 114754449 missense unknown
RF012:Dnaic2 UTSW 11 114750416 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAATGGACACTCTAGGCTC -3'
(R):5'- AGTGACTTGTCCCTGATCTGTC -3'

Sequencing Primer
(F):5'- GACACTCTAGGCTCCCAGC -3'
(R):5'- GAAGAAGGAAACTCAACTTTTCGC -3'
Posted On2014-11-12