Incidental Mutation 'R2430:Tnfsf11'
ID250381
Institutional Source Beutler Lab
Gene Symbol Tnfsf11
Ensembl Gene ENSMUSG00000022015
Gene Nametumor necrosis factor (ligand) superfamily, member 11
SynonymsOPGL, Ly109l, RANKL, ODF, Trance, OPGL, osteoclast differentiation factor
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R2430 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location78277445-78308043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 78284312 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 152 (D152E)
Ref Sequence ENSEMBL: ENSMUSP00000022592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022592]
PDB Structure
CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF MOUSE RANK LIGAND [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF TRANCE/RANKL CYTOKINE. [X-RAY DIFFRACTION]
Mouse RANKL Structure at 1.9A Resolution [X-RAY DIFFRACTION]
Crystal structure of mouse RANKL-RANK complex [X-RAY DIFFRACTION]
Crystal structure of extracellular domains of mouse RANK-RANKL complex [X-RAY DIFFRACTION]
Crystal structure of mouse RANKL-OPG complex [X-RAY DIFFRACTION]
Crystal Structure of mouse RANK bound to RANKL [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000022592
AA Change: D152E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022592
Gene: ENSMUSG00000022015
AA Change: D152E

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
transmembrane domain 49 71 N/A INTRINSIC
TNF 163 312 7.37e-58 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor (TNF) cytokine family which is a ligand for osteoprotegerin and functions as a key factor for osteoclast differentiation and activation. This protein was shown to be a dentritic cell survival factor and is involved in the regulation of T cell-dependent immune response. T cell activation was reported to induce expression of this gene and lead to an increase of osteoclastogenesis and bone loss. This protein was shown to activate antiapoptotic kinase AKT/PKB through a signaling complex involving SRC kinase and tumor necrosis factor receptor-associated factor (TRAF) 6, which indicated this protein may have a role in the regulation of cell apoptosis. Targeted disruption of the related gene in mice led to severe osteopetrosis and a lack of osteoclasts. The deficient mice exhibited defects in early differentiation of T and B lymphocytes, and failed to form lobulo-alveolar mammary structures during pregnancy. Two alternatively spliced transcript variants have been found. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit a failure of tooth eruption, osteopetrosis, failure to lactate and arrested alveolar bud differentiation during pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc T C 15: 74,671,891 E161G probably benign Het
Ass1 A G 2: 31,501,496 H261R probably damaging Het
Car11 T A 7: 45,703,648 probably null Het
Crebbp T C 16: 4,096,465 H844R probably damaging Het
Dnaic2 A G 11: 114,757,186 probably benign Het
Eya2 T C 2: 165,716,130 probably null Het
Klhl40 A G 9: 121,780,601 D484G possibly damaging Het
Knstrn A G 2: 118,834,103 probably benign Het
Nckap5 A G 1: 125,914,757 S1838P probably damaging Het
Nipsnap2 A G 5: 129,744,791 D117G possibly damaging Het
Nudt15 C T 14: 73,525,302 probably benign Het
Olfr1082 A G 2: 86,594,708 I40T probably benign Het
Olfr1140 T A 2: 87,746,655 M153K possibly damaging Het
Pcdh20 T C 14: 88,467,548 D772G probably damaging Het
Pdss1 T A 2: 22,929,593 Y289* probably null Het
Phc2 A T 4: 128,707,983 Y77F probably damaging Het
Ppip5k2 A T 1: 97,735,030 Y667N probably damaging Het
Prdm2 A G 4: 143,133,163 S1186P possibly damaging Het
Prr36 A T 8: 4,213,488 probably benign Het
Reck C T 4: 43,930,202 T592I possibly damaging Het
Rprd2 T A 3: 95,764,795 K1015* probably null Het
Tfrc T G 16: 32,626,711 Y617D probably damaging Het
Vmn2r54 T A 7: 12,632,006 I334F probably damaging Het
Other mutations in Tnfsf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02601:Tnfsf11 APN 14 78299945 nonsense probably null
R0352:Tnfsf11 UTSW 14 78278968 missense probably benign 0.17
R0377:Tnfsf11 UTSW 14 78299912 missense probably benign 0.00
R2062:Tnfsf11 UTSW 14 78278922 missense probably damaging 1.00
R2121:Tnfsf11 UTSW 14 78299893 missense probably benign 0.32
R2178:Tnfsf11 UTSW 14 78284242 missense probably benign 0.00
R2237:Tnfsf11 UTSW 14 78299981 missense possibly damaging 0.77
R2238:Tnfsf11 UTSW 14 78299981 missense possibly damaging 0.77
R2239:Tnfsf11 UTSW 14 78299981 missense possibly damaging 0.77
R4155:Tnfsf11 UTSW 14 78299869 missense probably benign 0.28
R4197:Tnfsf11 UTSW 14 78284312 missense probably benign 0.00
R4562:Tnfsf11 UTSW 14 78278580 missense probably damaging 1.00
R6141:Tnfsf11 UTSW 14 78307859 missense probably damaging 0.99
R8063:Tnfsf11 UTSW 14 78278658 missense probably damaging 1.00
X0020:Tnfsf11 UTSW 14 78278877 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAAGGTAGGGTTCAACTG -3'
(R):5'- CCCGCTGCTTTACACAAAG -3'

Sequencing Primer
(F):5'- AGGGTTCAACTGAAGGGTTTACC -3'
(R):5'- CGCTGCTTTACACAAAGAATGAG -3'
Posted On2014-11-12