Incidental Mutation 'R2430:Tnfsf11'
ID 250381
Institutional Source Beutler Lab
Gene Symbol Tnfsf11
Ensembl Gene ENSMUSG00000022015
Gene Name tumor necrosis factor (ligand) superfamily, member 11
Synonyms Ly109l, Trance, osteoclast differentiation factor, RANKL, OPGL, OPGL, ODF
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.435) question?
Stock # R2430 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 78514886-78545483 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 78521752 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 152 (D152E)
Ref Sequence ENSEMBL: ENSMUSP00000022592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022592]
AlphaFold O35235
PDB Structure CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF MOUSE RANK LIGAND [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF TRANCE/RANKL CYTOKINE. [X-RAY DIFFRACTION]
Mouse RANKL Structure at 1.9A Resolution [X-RAY DIFFRACTION]
Crystal structure of mouse RANKL-RANK complex [X-RAY DIFFRACTION]
Crystal structure of extracellular domains of mouse RANK-RANKL complex [X-RAY DIFFRACTION]
Crystal structure of mouse RANKL-OPG complex [X-RAY DIFFRACTION]
Crystal Structure of mouse RANK bound to RANKL [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000022592
AA Change: D152E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022592
Gene: ENSMUSG00000022015
AA Change: D152E

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
transmembrane domain 49 71 N/A INTRINSIC
TNF 163 312 7.37e-58 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor (TNF) cytokine family which is a ligand for osteoprotegerin and functions as a key factor for osteoclast differentiation and activation. This protein was shown to be a dentritic cell survival factor and is involved in the regulation of T cell-dependent immune response. T cell activation was reported to induce expression of this gene and lead to an increase of osteoclastogenesis and bone loss. This protein was shown to activate antiapoptotic kinase AKT/PKB through a signaling complex involving SRC kinase and tumor necrosis factor receptor-associated factor (TRAF) 6, which indicated this protein may have a role in the regulation of cell apoptosis. Targeted disruption of the related gene in mice led to severe osteopetrosis and a lack of osteoclasts. The deficient mice exhibited defects in early differentiation of T and B lymphocytes, and failed to form lobulo-alveolar mammary structures during pregnancy. Two alternatively spliced transcript variants have been found. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit a failure of tooth eruption, osteopetrosis, failure to lactate and arrested alveolar bud differentiation during pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc T C 15: 74,543,740 (GRCm39) E161G probably benign Het
Ass1 A G 2: 31,391,508 (GRCm39) H261R probably damaging Het
Car11 T A 7: 45,353,072 (GRCm39) probably null Het
Crebbp T C 16: 3,914,329 (GRCm39) H844R probably damaging Het
Dnai2 A G 11: 114,648,012 (GRCm39) probably benign Het
Eya2 T C 2: 165,558,050 (GRCm39) probably null Het
Klhl40 A G 9: 121,609,667 (GRCm39) D484G possibly damaging Het
Knstrn A G 2: 118,664,584 (GRCm39) probably benign Het
Nckap5 A G 1: 125,842,494 (GRCm39) S1838P probably damaging Het
Nipsnap2 A G 5: 129,821,855 (GRCm39) D117G possibly damaging Het
Nudt15 C T 14: 73,762,742 (GRCm39) probably benign Het
Or5w16 T A 2: 87,576,999 (GRCm39) M153K possibly damaging Het
Or8k35 A G 2: 86,425,052 (GRCm39) I40T probably benign Het
Pcdh20 T C 14: 88,704,984 (GRCm39) D772G probably damaging Het
Pdss1 T A 2: 22,819,605 (GRCm39) Y289* probably null Het
Phc2 A T 4: 128,601,776 (GRCm39) Y77F probably damaging Het
Ppip5k2 A T 1: 97,662,755 (GRCm39) Y667N probably damaging Het
Prdm2 A G 4: 142,859,733 (GRCm39) S1186P possibly damaging Het
Prr36 A T 8: 4,263,488 (GRCm39) probably benign Het
Reck C T 4: 43,930,202 (GRCm39) T592I possibly damaging Het
Rprd2 T A 3: 95,672,107 (GRCm39) K1015* probably null Het
Tfrc T G 16: 32,445,529 (GRCm39) Y617D probably damaging Het
Vmn2r54 T A 7: 12,365,933 (GRCm39) I334F probably damaging Het
Other mutations in Tnfsf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02601:Tnfsf11 APN 14 78,537,385 (GRCm39) nonsense probably null
R0352:Tnfsf11 UTSW 14 78,516,408 (GRCm39) missense probably benign 0.17
R0377:Tnfsf11 UTSW 14 78,537,352 (GRCm39) missense probably benign 0.00
R2062:Tnfsf11 UTSW 14 78,516,362 (GRCm39) missense probably damaging 1.00
R2121:Tnfsf11 UTSW 14 78,537,333 (GRCm39) missense probably benign 0.32
R2178:Tnfsf11 UTSW 14 78,521,682 (GRCm39) missense probably benign 0.00
R2237:Tnfsf11 UTSW 14 78,537,421 (GRCm39) missense possibly damaging 0.77
R2238:Tnfsf11 UTSW 14 78,537,421 (GRCm39) missense possibly damaging 0.77
R2239:Tnfsf11 UTSW 14 78,537,421 (GRCm39) missense possibly damaging 0.77
R4155:Tnfsf11 UTSW 14 78,537,309 (GRCm39) missense probably benign 0.28
R4197:Tnfsf11 UTSW 14 78,521,752 (GRCm39) missense probably benign 0.00
R4562:Tnfsf11 UTSW 14 78,516,020 (GRCm39) missense probably damaging 1.00
R6141:Tnfsf11 UTSW 14 78,545,299 (GRCm39) missense probably damaging 0.99
R8063:Tnfsf11 UTSW 14 78,516,098 (GRCm39) missense probably damaging 1.00
R8904:Tnfsf11 UTSW 14 78,516,119 (GRCm39) missense possibly damaging 0.88
X0020:Tnfsf11 UTSW 14 78,516,317 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAAGGTAGGGTTCAACTG -3'
(R):5'- CCCGCTGCTTTACACAAAG -3'

Sequencing Primer
(F):5'- AGGGTTCAACTGAAGGGTTTACC -3'
(R):5'- CGCTGCTTTACACAAAGAATGAG -3'
Posted On 2014-11-12