Incidental Mutation 'R2430:Pcdh20'
List |< first << previous [record 14 of 24] next >> last >|
ID250382
Institutional Source Beutler Lab
Gene Symbol Pcdh20
Ensembl Gene ENSMUSG00000050505
Gene Nameprotocadherin 20
SynonymsC630015B17Rik, PCDH13
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2430 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location88464743-88471396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88467548 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 772 (D772G)
Ref Sequence ENSEMBL: ENSMUSP00000141860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061628] [ENSMUST00000192557]
Predicted Effect probably damaging
Transcript: ENSMUST00000061628
AA Change: D772G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054774
Gene: ENSMUSG00000050505
AA Change: D772G

DomainStartEndE-ValueType
CA 108 208 9.02e-1 SMART
CA 233 319 6.63e-16 SMART
CA 343 425 9.94e-2 SMART
CA 455 534 7.48e-3 SMART
CA 558 638 5.46e-26 SMART
CA 662 741 7.2e-26 SMART
CA 768 852 9.6e-13 SMART
low complexity region 860 871 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192557
AA Change: D772G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141860
Gene: ENSMUSG00000050505
AA Change: D772G

DomainStartEndE-ValueType
CA 108 208 9.02e-1 SMART
CA 233 319 6.63e-16 SMART
CA 343 425 9.94e-2 SMART
CA 455 534 7.48e-3 SMART
CA 558 638 5.46e-26 SMART
CA 662 741 7.2e-26 SMART
CA 768 852 9.6e-13 SMART
low complexity region 860 871 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein contains six extracellular cadherin domains, a transmembrane domain, and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein may play a role in cell adhesion in the nervous system and has been shown to be specifically expressed in newly differentiated olfactory sensory neurons and their axons during development. In adult mice, the expression of this protein in the olfactory system is more restricted but shows a gender difference with higher expression in the male than in the female. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc T C 15: 74,671,891 E161G probably benign Het
Ass1 A G 2: 31,501,496 H261R probably damaging Het
Car11 T A 7: 45,703,648 probably null Het
Crebbp T C 16: 4,096,465 H844R probably damaging Het
Dnaic2 A G 11: 114,757,186 probably benign Het
Eya2 T C 2: 165,716,130 probably null Het
Klhl40 A G 9: 121,780,601 D484G possibly damaging Het
Knstrn A G 2: 118,834,103 probably benign Het
Nckap5 A G 1: 125,914,757 S1838P probably damaging Het
Nipsnap2 A G 5: 129,744,791 D117G possibly damaging Het
Nudt15 C T 14: 73,525,302 probably benign Het
Olfr1082 A G 2: 86,594,708 I40T probably benign Het
Olfr1140 T A 2: 87,746,655 M153K possibly damaging Het
Pdss1 T A 2: 22,929,593 Y289* probably null Het
Phc2 A T 4: 128,707,983 Y77F probably damaging Het
Ppip5k2 A T 1: 97,735,030 Y667N probably damaging Het
Prdm2 A G 4: 143,133,163 S1186P possibly damaging Het
Prr36 A T 8: 4,213,488 probably benign Het
Reck C T 4: 43,930,202 T592I possibly damaging Het
Rprd2 T A 3: 95,764,795 K1015* probably null Het
Tfrc T G 16: 32,626,711 Y617D probably damaging Het
Tnfsf11 A C 14: 78,284,312 D152E probably benign Het
Vmn2r54 T A 7: 12,632,006 I334F probably damaging Het
Other mutations in Pcdh20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Pcdh20 APN 14 88467881 missense possibly damaging 0.65
IGL01112:Pcdh20 APN 14 88467200 missense probably benign 0.01
IGL01586:Pcdh20 APN 14 88470908 missense probably benign 0.37
IGL02007:Pcdh20 APN 14 88469595 missense probably benign 0.09
IGL02545:Pcdh20 APN 14 88468844 missense possibly damaging 0.74
IGL02935:Pcdh20 APN 14 88467002 utr 3 prime probably benign
PIT4362001:Pcdh20 UTSW 14 88467026 missense probably damaging 0.97
PIT4403001:Pcdh20 UTSW 14 88467026 missense probably damaging 0.97
PIT4453001:Pcdh20 UTSW 14 88467308 missense probably damaging 1.00
R0322:Pcdh20 UTSW 14 88468947 missense probably benign 0.24
R0372:Pcdh20 UTSW 14 88469003 missense probably damaging 1.00
R0391:Pcdh20 UTSW 14 88468668 missense probably benign
R0575:Pcdh20 UTSW 14 88467612 missense probably damaging 1.00
R0789:Pcdh20 UTSW 14 88468790 missense probably damaging 1.00
R1370:Pcdh20 UTSW 14 88468301 missense probably benign 0.00
R1465:Pcdh20 UTSW 14 88469237 missense probably benign 0.00
R1465:Pcdh20 UTSW 14 88469237 missense probably benign 0.00
R1664:Pcdh20 UTSW 14 88468322 missense possibly damaging 0.63
R1677:Pcdh20 UTSW 14 88467974 missense probably damaging 1.00
R1764:Pcdh20 UTSW 14 88469184 missense possibly damaging 0.77
R1907:Pcdh20 UTSW 14 88468704 missense probably benign 0.01
R2043:Pcdh20 UTSW 14 88467155 missense probably benign 0.01
R2471:Pcdh20 UTSW 14 88467236 missense probably benign 0.00
R3838:Pcdh20 UTSW 14 88468463 missense probably benign 0.00
R4163:Pcdh20 UTSW 14 88468179 missense probably damaging 1.00
R4472:Pcdh20 UTSW 14 88468998 missense probably benign 0.21
R4602:Pcdh20 UTSW 14 88468430 missense probably damaging 1.00
R4681:Pcdh20 UTSW 14 88467616 missense probably damaging 1.00
R4918:Pcdh20 UTSW 14 88467668 missense probably damaging 1.00
R4921:Pcdh20 UTSW 14 88469726 missense probably benign 0.01
R5204:Pcdh20 UTSW 14 88468915 missense probably damaging 1.00
R5256:Pcdh20 UTSW 14 88468377 missense probably benign
R5652:Pcdh20 UTSW 14 88467324 missense probably damaging 1.00
R5815:Pcdh20 UTSW 14 88470876 missense probably benign 0.03
R6195:Pcdh20 UTSW 14 88468052 missense probably benign 0.39
R6233:Pcdh20 UTSW 14 88468052 missense probably benign 0.39
R6848:Pcdh20 UTSW 14 88467254 missense probably benign 0.03
R6913:Pcdh20 UTSW 14 88468602 missense probably benign
R7044:Pcdh20 UTSW 14 88469171 missense probably damaging 0.98
R7224:Pcdh20 UTSW 14 88469075 missense possibly damaging 0.85
R7388:Pcdh20 UTSW 14 88468667 missense probably benign 0.33
R7486:Pcdh20 UTSW 14 88468614 missense possibly damaging 0.79
R7651:Pcdh20 UTSW 14 88469153 missense probably damaging 1.00
R7664:Pcdh20 UTSW 14 88469367 missense probably benign
R7706:Pcdh20 UTSW 14 88467357 missense probably damaging 1.00
R7832:Pcdh20 UTSW 14 88469707 missense probably null 0.02
R7892:Pcdh20 UTSW 14 88467431 nonsense probably null
R8218:Pcdh20 UTSW 14 88468611 missense probably damaging 0.96
X0028:Pcdh20 UTSW 14 88467617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCACCATGACTGTGGAG -3'
(R):5'- CTTACACTCTGTGGGTGGAG -3'

Sequencing Primer
(F):5'- CTCAGGGTATCCGTGATCAC -3'
(R):5'- TGGAGGCTGTTGACGGG -3'
Posted On2014-11-12