Incidental Mutation 'R2430:Arc'
List [record 1 of 24] next >> last >|
ID250384
Institutional Source Beutler Lab
Gene Symbol Arc
Ensembl Gene ENSMUSG00000022602
Gene Nameactivity regulated cytoskeletal-associated protein
SynonymsArc3.1, arg 3.1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2430 (G1)
Quality Score116
Status Not validated
Chromosome15
Chromosomal Location74669083-74672570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74671891 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 161 (E161G)
Ref Sequence ENSEMBL: ENSMUSP00000105636 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000023268
AA Change: E161G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000110009
AA Change: E161G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous deletion of this gene results in embryonic lethality around E6.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ass1 A G 2: 31,501,496 H261R probably damaging Het
Car11 T A 7: 45,703,648 probably null Het
Crebbp T C 16: 4,096,465 H844R probably damaging Het
Dnaic2 A G 11: 114,757,186 probably benign Het
Eya2 T C 2: 165,716,130 probably null Het
Klhl40 A G 9: 121,780,601 D484G possibly damaging Het
Knstrn A G 2: 118,834,103 probably benign Het
Nckap5 A G 1: 125,914,757 S1838P probably damaging Het
Nipsnap2 A G 5: 129,744,791 D117G possibly damaging Het
Nudt15 C T 14: 73,525,302 probably benign Het
Olfr1082 A G 2: 86,594,708 I40T probably benign Het
Olfr1140 T A 2: 87,746,655 M153K possibly damaging Het
Pcdh20 T C 14: 88,467,548 D772G probably damaging Het
Pdss1 T A 2: 22,929,593 Y289* probably null Het
Phc2 A T 4: 128,707,983 Y77F probably damaging Het
Ppip5k2 A T 1: 97,735,030 Y667N probably damaging Het
Prdm2 A G 4: 143,133,163 S1186P possibly damaging Het
Prr36 A T 8: 4,213,488 probably benign Het
Reck C T 4: 43,930,202 T592I possibly damaging Het
Rprd2 T A 3: 95,764,795 K1015* probably null Het
Tfrc T G 16: 32,626,711 Y617D probably damaging Het
Tnfsf11 A C 14: 78,284,312 D152E probably benign Het
Vmn2r54 T A 7: 12,632,006 I334F probably damaging Het
Other mutations in Arc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Arc APN 15 74672355 missense probably benign
IGL02372:Arc APN 15 74672105 missense probably damaging 1.00
IGL03209:Arc APN 15 74671984 missense probably damaging 1.00
P0040:Arc UTSW 15 74671339 missense probably damaging 1.00
R0732:Arc UTSW 15 74671195 missense probably damaging 1.00
R1377:Arc UTSW 15 74672252 missense possibly damaging 0.51
R4647:Arc UTSW 15 74671525 missense probably damaging 1.00
R4855:Arc UTSW 15 74671743 missense probably benign 0.01
R6436:Arc UTSW 15 74672249 missense possibly damaging 0.47
R6743:Arc UTSW 15 74671787 missense probably benign
RF003:Arc UTSW 15 74672131 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACTCTTCCAGGTGGCTCAG -3'
(R):5'- GTCCATCAAGGCCTGTCTTTG -3'

Sequencing Primer
(F):5'- TTCCAGGTGGCTCAGGAACTC -3'
(R):5'- GAGACCATCGCCAACCTGGAG -3'
Posted On2014-11-12