Incidental Mutation 'R2431:Vtcn1'
ID250389
Institutional Source Beutler Lab
Gene Symbol Vtcn1
Ensembl Gene ENSMUSG00000051076
Gene NameV-set domain containing T cell activation inhibitor 1
SynonymsB7x, B7-H4
MMRRC Submission 040392-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R2431 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location100825459-100896922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100825577 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 7 (I7F)
Ref Sequence ENSEMBL: ENSMUSP00000057721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054791]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054791
AA Change: I7F

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057721
Gene: ENSMUSG00000051076
AA Change: I7F

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
IG 41 146 3.13e-5 SMART
Blast:IG_like 153 243 5e-39 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the B7 costimulatory protein family. Proteins in this family are present on the surface of antigen-presenting cells and interact with ligand bound to receptors on the surface of T cells. Studies have shown that high levels of the encoded protein has been correlated with tumor progression. A pseudogene of this gene is located on chromosome 20. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for this mutation display stronger Th1 responses upon parasitic infection by L. major including reduced footpad swelling and lower parasite burden compared to controls. Responses to other Th1-driven immune responses are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 T C 11: 97,452,404 V504A probably benign Het
Atr T G 9: 95,862,892 N87K probably benign Het
Auts2 A T 5: 132,259,048 L32* probably null Het
Bptf A G 11: 107,047,240 V2675A possibly damaging Het
Brdt C T 5: 107,378,015 probably null Het
Ccdc162 T C 10: 41,569,845 K444E probably benign Het
Cnot1 T C 8: 95,774,652 D96G probably damaging Het
Cpq C A 15: 33,594,119 Y425* probably null Het
Eri1 A G 8: 35,476,478 Y221H probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Focad T C 4: 88,331,027 V837A unknown Het
Ica1 G A 6: 8,658,265 T284I probably benign Het
Isg15 C T 4: 156,200,701 probably null Het
Ltbp4 T C 7: 27,319,676 T1073A possibly damaging Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr1444 T C 19: 12,862,606 V277A probably damaging Het
Olfr447 T C 6: 42,912,012 L163S probably damaging Het
Olfr703 T C 7: 106,845,391 V260A possibly damaging Het
Olfr834 A G 9: 18,988,003 N5S probably damaging Het
Piezo2 T C 18: 63,245,624 H78R possibly damaging Het
Pkd1l1 T C 11: 8,947,197 N121D probably damaging Het
Pkhd1 T C 1: 20,201,165 T3055A possibly damaging Het
Ppp5c C T 7: 17,015,425 V160M probably damaging Het
Ptpn23 G A 9: 110,386,279 R1438* probably null Het
Ptpro G A 6: 137,443,585 W183* probably null Het
Pygm T C 19: 6,393,785 M592T probably damaging Het
Qdpr A G 5: 45,444,730 V68A probably damaging Het
Rfc5 A C 5: 117,385,458 S92A probably damaging Het
Ripor3 T C 2: 167,989,795 Q362R probably benign Het
Ror1 G A 4: 100,441,155 C575Y probably damaging Het
Skint9 T A 4: 112,389,267 D216V probably damaging Het
Sox6 T C 7: 115,550,007 probably null Het
Ugp2 A T 11: 21,329,025 V387D probably damaging Het
Umodl1 T C 17: 30,992,088 S747P possibly damaging Het
Zfp507 C T 7: 35,795,402 R72H probably benign Het
Other mutations in Vtcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Vtcn1 APN 3 100888347 missense probably damaging 1.00
IGL02376:Vtcn1 APN 3 100892665 missense probably benign 0.05
IGL02833:Vtcn1 APN 3 100888385 missense probably damaging 1.00
IGL02876:Vtcn1 APN 3 100883829 missense probably damaging 0.97
IGL03018:Vtcn1 APN 3 100883910 missense probably damaging 0.98
R4194:Vtcn1 UTSW 3 100888209 missense probably damaging 0.97
R4881:Vtcn1 UTSW 3 100892593 missense probably benign
R6916:Vtcn1 UTSW 3 100888163 critical splice acceptor site probably null
R7147:Vtcn1 UTSW 3 100883894 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTTCCTCATACCTGAGCCG -3'
(R):5'- GTTGCTCAGGGCTGCTAAAG -3'

Sequencing Primer
(F):5'- TGAGCCGTCCACAGCTACATG -3'
(R):5'- GGGCTGCTAAAGTTGCTTATTAACC -3'
Posted On2014-11-12