Incidental Mutation 'R2431:Mmp16'
ID250390
Institutional Source Beutler Lab
Gene Symbol Mmp16
Ensembl Gene ENSMUSG00000028226
Gene Namematrix metallopeptidase 16
SynonymsMT3-MMP, Membrane type 3-MMP
MMRRC Submission 040392-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2431 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location17852893-18119145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18054491 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 332 (R332S)
Ref Sequence ENSEMBL: ENSMUSP00000029881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029881] [ENSMUST00000183662]
Predicted Effect probably benign
Transcript: ENSMUST00000029881
AA Change: R332S

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029881
Gene: ENSMUSG00000028226
AA Change: R332S

DomainStartEndE-ValueType
Pfam:PG_binding_1 38 96 3e-11 PFAM
ZnMc 123 292 1.62e-54 SMART
low complexity region 313 336 N/A INTRINSIC
HX 347 390 1.36e-7 SMART
HX 392 436 3.61e-12 SMART
HX 439 485 1.86e-14 SMART
HX 487 532 4.96e-10 SMART
Pfam:DUF3377 537 607 6.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139418
Predicted Effect probably benign
Transcript: ENSMUST00000183662
AA Change: R332S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139102
Gene: ENSMUSG00000028226
AA Change: R332S

DomainStartEndE-ValueType
Pfam:PG_binding_1 38 96 9.9e-12 PFAM
ZnMc 123 292 1.62e-54 SMART
low complexity region 313 336 N/A INTRINSIC
HX 347 390 1.36e-7 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein exhibit retarded growth of the skeleton, especially in the cranium and long bones. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene disruption display normal morphology, clinical chemistry, hematology, and behavior. Mice homozygous for a null allele exhibit reduced skeletal growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 T C 11: 97,452,404 V504A probably benign Het
Atr T G 9: 95,862,892 N87K probably benign Het
Auts2 A T 5: 132,259,048 L32* probably null Het
Bptf A G 11: 107,047,240 V2675A possibly damaging Het
Brdt C T 5: 107,378,015 probably null Het
Ccdc162 T C 10: 41,569,845 K444E probably benign Het
Cnot1 T C 8: 95,774,652 D96G probably damaging Het
Cpq C A 15: 33,594,119 Y425* probably null Het
Eri1 A G 8: 35,476,478 Y221H probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Focad T C 4: 88,331,027 V837A unknown Het
Ica1 G A 6: 8,658,265 T284I probably benign Het
Isg15 C T 4: 156,200,701 probably null Het
Ltbp4 T C 7: 27,319,676 T1073A possibly damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr1444 T C 19: 12,862,606 V277A probably damaging Het
Olfr447 T C 6: 42,912,012 L163S probably damaging Het
Olfr703 T C 7: 106,845,391 V260A possibly damaging Het
Olfr834 A G 9: 18,988,003 N5S probably damaging Het
Piezo2 T C 18: 63,245,624 H78R possibly damaging Het
Pkd1l1 T C 11: 8,947,197 N121D probably damaging Het
Pkhd1 T C 1: 20,201,165 T3055A possibly damaging Het
Ppp5c C T 7: 17,015,425 V160M probably damaging Het
Ptpn23 G A 9: 110,386,279 R1438* probably null Het
Ptpro G A 6: 137,443,585 W183* probably null Het
Pygm T C 19: 6,393,785 M592T probably damaging Het
Qdpr A G 5: 45,444,730 V68A probably damaging Het
Rfc5 A C 5: 117,385,458 S92A probably damaging Het
Ripor3 T C 2: 167,989,795 Q362R probably benign Het
Ror1 G A 4: 100,441,155 C575Y probably damaging Het
Skint9 T A 4: 112,389,267 D216V probably damaging Het
Sox6 T C 7: 115,550,007 probably null Het
Ugp2 A T 11: 21,329,025 V387D probably damaging Het
Umodl1 T C 17: 30,992,088 S747P possibly damaging Het
Vtcn1 A T 3: 100,825,577 I7F possibly damaging Het
Zfp507 C T 7: 35,795,402 R72H probably benign Het
Other mutations in Mmp16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Mmp16 APN 4 18011784 missense probably benign 0.03
IGL01074:Mmp16 APN 4 18110584 splice site probably benign
IGL01125:Mmp16 APN 4 18112066 missense possibly damaging 0.95
IGL01309:Mmp16 APN 4 18116185 missense probably damaging 0.98
IGL01543:Mmp16 APN 4 18051743 missense probably damaging 1.00
IGL02036:Mmp16 APN 4 18093371 missense probably benign 0.00
IGL02252:Mmp16 APN 4 18110523 missense probably damaging 1.00
IGL03037:Mmp16 APN 4 17996222 missense probably damaging 0.98
R0483:Mmp16 UTSW 4 18115878 splice site probably benign
R0565:Mmp16 UTSW 4 17987705 missense probably damaging 1.00
R0885:Mmp16 UTSW 4 18054491 missense probably benign 0.12
R0966:Mmp16 UTSW 4 18115930 missense probably benign 0.31
R1158:Mmp16 UTSW 4 17987726 splice site probably null
R1290:Mmp16 UTSW 4 18051725 missense probably damaging 1.00
R1326:Mmp16 UTSW 4 18054517 missense possibly damaging 0.61
R1345:Mmp16 UTSW 4 18112021 missense probably benign 0.01
R1424:Mmp16 UTSW 4 18112121 splice site probably null
R1610:Mmp16 UTSW 4 18011582 missense probably benign 0.00
R1722:Mmp16 UTSW 4 18051767 missense probably damaging 1.00
R1867:Mmp16 UTSW 4 18116013 missense probably benign 0.00
R2354:Mmp16 UTSW 4 18112001 missense probably damaging 1.00
R2992:Mmp16 UTSW 4 18011657 missense probably damaging 1.00
R5245:Mmp16 UTSW 4 18054596 intron probably benign
R5534:Mmp16 UTSW 4 18110452 missense probably damaging 0.99
R5941:Mmp16 UTSW 4 18054354 splice site probably benign
R5961:Mmp16 UTSW 4 17853842 missense probably benign 0.37
R6160:Mmp16 UTSW 4 18051857 missense probably damaging 1.00
R6514:Mmp16 UTSW 4 18116123 missense probably damaging 1.00
R6570:Mmp16 UTSW 4 18011501 missense possibly damaging 0.64
R6866:Mmp16 UTSW 4 17853800 missense probably benign 0.23
R7037:Mmp16 UTSW 4 18116148 missense possibly damaging 0.95
R7168:Mmp16 UTSW 4 18110550 missense probably damaging 1.00
R7268:Mmp16 UTSW 4 18093366 missense probably benign
R7635:Mmp16 UTSW 4 18054382 missense probably benign 0.00
R7799:Mmp16 UTSW 4 18112112 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAAGCGCTTGTTCTCTGTAGC -3'
(R):5'- TAACTGCGAGAGGTCCTGGAAG -3'

Sequencing Primer
(F):5'- AGCATATTTTCCAGCTCTATTCCAG -3'
(R):5'- CTCCCTTCGAAGAATAGCTAG -3'
Posted On2014-11-12