Incidental Mutation 'R2431:Focad'
ID250391
Institutional Source Beutler Lab
Gene Symbol Focad
Ensembl Gene ENSMUSG00000038368
Gene Namefocadhesin
SynonymsBC057079
MMRRC Submission 040392-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.454) question?
Stock #R2431 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location88094629-88411011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88331027 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 837 (V837A)
Ref Sequence ENSEMBL: ENSMUSP00000124298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000159342]
Predicted Effect unknown
Transcript: ENSMUST00000097992
AA Change: V923A
SMART Domains Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368
AA Change: V923A

DomainStartEndE-ValueType
low complexity region 150 161 N/A INTRINSIC
low complexity region 194 203 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 490 714 1.5e-71 PFAM
low complexity region 957 969 N/A INTRINSIC
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1200 1209 N/A INTRINSIC
Pfam:DUF3028 1210 1798 1.5e-291 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130603
Predicted Effect unknown
Transcript: ENSMUST00000159342
AA Change: V837A
SMART Domains Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368
AA Change: V837A

DomainStartEndE-ValueType
Pfam:DUF3730 20 250 5.8e-27 PFAM
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 403 633 2.8e-61 PFAM
low complexity region 871 883 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1114 1123 N/A INTRINSIC
Pfam:DUF3028 1124 1712 N/A PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 T C 11: 97,452,404 V504A probably benign Het
Atr T G 9: 95,862,892 N87K probably benign Het
Auts2 A T 5: 132,259,048 L32* probably null Het
Bptf A G 11: 107,047,240 V2675A possibly damaging Het
Brdt C T 5: 107,378,015 probably null Het
Ccdc162 T C 10: 41,569,845 K444E probably benign Het
Cnot1 T C 8: 95,774,652 D96G probably damaging Het
Cpq C A 15: 33,594,119 Y425* probably null Het
Eri1 A G 8: 35,476,478 Y221H probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Ica1 G A 6: 8,658,265 T284I probably benign Het
Isg15 C T 4: 156,200,701 probably null Het
Ltbp4 T C 7: 27,319,676 T1073A possibly damaging Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr1444 T C 19: 12,862,606 V277A probably damaging Het
Olfr447 T C 6: 42,912,012 L163S probably damaging Het
Olfr703 T C 7: 106,845,391 V260A possibly damaging Het
Olfr834 A G 9: 18,988,003 N5S probably damaging Het
Piezo2 T C 18: 63,245,624 H78R possibly damaging Het
Pkd1l1 T C 11: 8,947,197 N121D probably damaging Het
Pkhd1 T C 1: 20,201,165 T3055A possibly damaging Het
Ppp5c C T 7: 17,015,425 V160M probably damaging Het
Ptpn23 G A 9: 110,386,279 R1438* probably null Het
Ptpro G A 6: 137,443,585 W183* probably null Het
Pygm T C 19: 6,393,785 M592T probably damaging Het
Qdpr A G 5: 45,444,730 V68A probably damaging Het
Rfc5 A C 5: 117,385,458 S92A probably damaging Het
Ripor3 T C 2: 167,989,795 Q362R probably benign Het
Ror1 G A 4: 100,441,155 C575Y probably damaging Het
Skint9 T A 4: 112,389,267 D216V probably damaging Het
Sox6 T C 7: 115,550,007 probably null Het
Ugp2 A T 11: 21,329,025 V387D probably damaging Het
Umodl1 T C 17: 30,992,088 S747P possibly damaging Het
Vtcn1 A T 3: 100,825,577 I7F possibly damaging Het
Zfp507 C T 7: 35,795,402 R72H probably benign Het
Other mutations in Focad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Focad APN 4 88357474 missense unknown
IGL00562:Focad APN 4 88348809 missense unknown
IGL00563:Focad APN 4 88348809 missense unknown
IGL00900:Focad APN 4 88129023 missense probably damaging 0.99
IGL00984:Focad APN 4 88344785 missense unknown
IGL01016:Focad APN 4 88392015 missense possibly damaging 0.51
IGL01069:Focad APN 4 88326146 missense unknown
IGL01305:Focad APN 4 88393547 missense probably benign 0.32
IGL01409:Focad APN 4 88342305 missense unknown
IGL01447:Focad APN 4 88326228 missense unknown
IGL01521:Focad APN 4 88410690 makesense probably null
IGL01672:Focad APN 4 88360590 critical splice donor site probably null
IGL01739:Focad APN 4 88370806 missense unknown
IGL02082:Focad APN 4 88230578 nonsense probably null
IGL02139:Focad APN 4 88129054 critical splice donor site probably null
IGL02381:Focad APN 4 88274090 splice site probably benign
IGL02898:Focad APN 4 88391997 missense probably benign 0.02
certitude UTSW 4 88178133 missense probably damaging 1.00
impression UTSW 4 88278242 missense unknown
Microscope UTSW 4 88342204 missense unknown
Nuance UTSW 4 88196846 intron probably benign
Objective UTSW 4 88401068 nonsense probably null
ANU22:Focad UTSW 4 88393547 missense probably benign 0.32
R0025:Focad UTSW 4 88408959 missense probably benign 0.02
R0554:Focad UTSW 4 88348889 missense unknown
R0617:Focad UTSW 4 88121288 unclassified probably benign
R0688:Focad UTSW 4 88274213 missense unknown
R0746:Focad UTSW 4 88397214 missense possibly damaging 0.84
R0907:Focad UTSW 4 88278261 critical splice donor site probably null
R1109:Focad UTSW 4 88196747 intron probably benign
R1136:Focad UTSW 4 88326180 missense unknown
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1412:Focad UTSW 4 88278261 critical splice donor site probably null
R1453:Focad UTSW 4 88357442 critical splice acceptor site probably null
R1697:Focad UTSW 4 88408988 missense probably damaging 0.98
R1739:Focad UTSW 4 88397891 missense probably benign 0.05
R1767:Focad UTSW 4 88357468 missense unknown
R1827:Focad UTSW 4 88229383 missense probably benign 0.03
R1866:Focad UTSW 4 88407165 missense possibly damaging 0.92
R1867:Focad UTSW 4 88178089 missense probably damaging 0.99
R1929:Focad UTSW 4 88342212 missense unknown
R1929:Focad UTSW 4 88397179 missense probably benign 0.32
R1937:Focad UTSW 4 88401081 start codon destroyed probably null
R1989:Focad UTSW 4 88232784 critical splice donor site probably null
R2176:Focad UTSW 4 88279244 missense unknown
R2393:Focad UTSW 4 88121330 missense probably damaging 0.96
R3195:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3196:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3730:Focad UTSW 4 88408925 missense possibly damaging 0.52
R3772:Focad UTSW 4 88336161 splice site probably benign
R4391:Focad UTSW 4 88185958 missense probably damaging 1.00
R4491:Focad UTSW 4 88359905 critical splice donor site probably null
R4492:Focad UTSW 4 88359905 critical splice donor site probably null
R4703:Focad UTSW 4 88342321 critical splice donor site probably null
R4788:Focad UTSW 4 88357469 missense unknown
R4923:Focad UTSW 4 88196846 intron probably benign
R5026:Focad UTSW 4 88344582 missense unknown
R5122:Focad UTSW 4 88407365 critical splice donor site probably null
R5153:Focad UTSW 4 88359884 missense unknown
R5369:Focad UTSW 4 88121373 splice site probably benign
R5414:Focad UTSW 4 88410702 utr 3 prime probably benign
R5839:Focad UTSW 4 88196846 intron probably benign
R5916:Focad UTSW 4 88357541 missense unknown
R5953:Focad UTSW 4 88229335 missense probably benign 0.01
R5991:Focad UTSW 4 88401019 missense possibly damaging 0.91
R6230:Focad UTSW 4 88342204 missense unknown
R6247:Focad UTSW 4 88407140 missense possibly damaging 0.92
R6324:Focad UTSW 4 88401068 nonsense probably null
R6543:Focad UTSW 4 88279256 missense unknown
R6639:Focad UTSW 4 88278242 missense unknown
R6802:Focad UTSW 4 88274203 missense unknown
R6802:Focad UTSW 4 88344684 missense unknown
R6866:Focad UTSW 4 88403386 missense probably benign 0.34
R6902:Focad UTSW 4 88230476 missense unknown
R6928:Focad UTSW 4 88348875 missense unknown
R7036:Focad UTSW 4 88124637 missense probably benign 0.05
R7057:Focad UTSW 4 88274105 missense unknown
R7077:Focad UTSW 4 88410677 missense unknown
R7242:Focad UTSW 4 88309906 missense unknown
R7357:Focad UTSW 4 88229335 missense probably benign 0.19
R7380:Focad UTSW 4 88274198 missense unknown
R7427:Focad UTSW 4 88368751 missense unknown
R7582:Focad UTSW 4 88229378 missense probably benign 0.00
R7661:Focad UTSW 4 88303535 missense unknown
R7688:Focad UTSW 4 88178133 missense probably damaging 1.00
R7789:Focad UTSW 4 88229406 missense unknown
R7880:Focad UTSW 4 88401170 missense unknown
R7887:Focad UTSW 4 88182616 missense probably damaging 1.00
R8024:Focad UTSW 4 88397000 missense unknown
R8129:Focad UTSW 4 88232763 missense unknown
R8369:Focad UTSW 4 88232668 missense unknown
X0035:Focad UTSW 4 88397922 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GACACTTGTGGCCTGTGG -3'
(R):5'- TTCCTTATCATATCTAAGAAGGAGGTG -3'

Sequencing Primer
(F):5'- TCCAATAGCTGACTGTGAGC -3'
(R):5'- AGGTGAAAATAAACCTCTGGGG -3'
Posted On2014-11-12