Incidental Mutation 'R2431:Skint9'
ID250393
Institutional Source Beutler Lab
Gene Symbol Skint9
Ensembl Gene ENSMUSG00000049972
Gene Nameselection and upkeep of intraepithelial T cells 9
Synonyms
MMRRC Submission 040392-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R2431 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location112385969-112433985 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112389267 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 216 (D216V)
Ref Sequence ENSEMBL: ENSMUSP00000052670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058605]
Predicted Effect probably damaging
Transcript: ENSMUST00000058605
AA Change: D216V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052670
Gene: ENSMUSG00000049972
AA Change: D216V

DomainStartEndE-ValueType
PDB:4F8T|A 26 125 1e-9 PDB
Blast:IG_like 32 119 8e-12 BLAST
SCOP:d1eula_ 154 245 5e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 T C 11: 97,452,404 V504A probably benign Het
Atr T G 9: 95,862,892 N87K probably benign Het
Auts2 A T 5: 132,259,048 L32* probably null Het
Bptf A G 11: 107,047,240 V2675A possibly damaging Het
Brdt C T 5: 107,378,015 probably null Het
Ccdc162 T C 10: 41,569,845 K444E probably benign Het
Cnot1 T C 8: 95,774,652 D96G probably damaging Het
Cpq C A 15: 33,594,119 Y425* probably null Het
Eri1 A G 8: 35,476,478 Y221H probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Focad T C 4: 88,331,027 V837A unknown Het
Ica1 G A 6: 8,658,265 T284I probably benign Het
Isg15 C T 4: 156,200,701 probably null Het
Ltbp4 T C 7: 27,319,676 T1073A possibly damaging Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr1444 T C 19: 12,862,606 V277A probably damaging Het
Olfr447 T C 6: 42,912,012 L163S probably damaging Het
Olfr703 T C 7: 106,845,391 V260A possibly damaging Het
Olfr834 A G 9: 18,988,003 N5S probably damaging Het
Piezo2 T C 18: 63,245,624 H78R possibly damaging Het
Pkd1l1 T C 11: 8,947,197 N121D probably damaging Het
Pkhd1 T C 1: 20,201,165 T3055A possibly damaging Het
Ppp5c C T 7: 17,015,425 V160M probably damaging Het
Ptpn23 G A 9: 110,386,279 R1438* probably null Het
Ptpro G A 6: 137,443,585 W183* probably null Het
Pygm T C 19: 6,393,785 M592T probably damaging Het
Qdpr A G 5: 45,444,730 V68A probably damaging Het
Rfc5 A C 5: 117,385,458 S92A probably damaging Het
Ripor3 T C 2: 167,989,795 Q362R probably benign Het
Ror1 G A 4: 100,441,155 C575Y probably damaging Het
Sox6 T C 7: 115,550,007 probably null Het
Ugp2 A T 11: 21,329,025 V387D probably damaging Het
Umodl1 T C 17: 30,992,088 S747P possibly damaging Het
Vtcn1 A T 3: 100,825,577 I7F possibly damaging Het
Zfp507 C T 7: 35,795,402 R72H probably benign Het
Other mutations in Skint9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02399:Skint9 APN 4 112389250 missense possibly damaging 0.88
IGL02417:Skint9 APN 4 112414138 splice site probably benign
IGL03111:Skint9 APN 4 112391724 missense probably benign 0.01
R0390:Skint9 UTSW 4 112389179 missense probably benign 0.21
R0400:Skint9 UTSW 4 112414001 missense probably damaging 1.00
R1606:Skint9 UTSW 4 112389201 missense probably benign 0.02
R1757:Skint9 UTSW 4 112413962 missense probably benign 0.03
R3195:Skint9 UTSW 4 112390951 missense probably benign 0.37
R3196:Skint9 UTSW 4 112390951 missense probably benign 0.37
R4329:Skint9 UTSW 4 112391865 missense probably damaging 0.98
R4855:Skint9 UTSW 4 112391011 missense probably benign
R4986:Skint9 UTSW 4 112391713 missense probably benign 0.00
R5093:Skint9 UTSW 4 112389250 missense probably benign 0.01
R5844:Skint9 UTSW 4 112413883 missense probably benign 0.01
R5897:Skint9 UTSW 4 112413916 missense possibly damaging 0.95
R7123:Skint9 UTSW 4 112390977 nonsense probably null
R7406:Skint9 UTSW 4 112389231 missense probably benign 0.00
R7591:Skint9 UTSW 4 112390950 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAAGAGACTTGAAGTACCCTG -3'
(R):5'- ATGGCTCAGACCAAACTGC -3'

Sequencing Primer
(F):5'- ACTTGAAGTACCCTGGAGATCCTTG -3'
(R):5'- CTGCAAAGCTTTGTCATAGAACC -3'
Posted On2014-11-12